Previous Contig 000555:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010K16Sequence535000555 (3)pir|T07080|T070803e-33shock protein SRC2 - soybean>gb:AB000130_1508294 Soybean mRNA for SRC2, complete801000555 (3)pir|T51602|T516022e-15shock protein SRC2 homolog [imported] - Arabidopsis thaliana>gb:ATH7586_1552950
JMFN009F16Sequence598000555 (3)pir|T07080|T070809e-38shock protein SRC2 - soybean>gb:AB000130_1508294 Soybean mRNA for SRC2, complete

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010K16- CTGTAATCA
                      ____________________________________________________________
consensus CTGTAATCA
 
. : . : . : . : . : . :
rJMFF010K16- TCCACATATATATGTACAAAATTATTAAAAGAACATTGGACACAAAAACGTAAGGCGGTG
                      ____________________________________________________________
consensus TCCACATATATATGTACAAAATTATTAAAAGAACATTGGACACAAAAACGTAAGGCGGTG
 
. : . : . : . : . : . :
rJMFF010K16- GGTGACAAATCAAAAATCAAAAATCAAATCCGCCGTCAAAACCGTCGTCATATCCGGCAT
                      ____________________________________________________________
consensus GGTGACAAATCAAAAATCAAAAATCAAATCCGCCGTCAAAACCGTCGTCATATCCGGCAT
 
. : . : . : . : . : . :
rJMFF010K16- CATAAGCGGCGGCGTCCGAAATCGCATCTCCGATCAGCATTCCTCCCAGCGCTCCACCTA
                      ____________________________________________________________
consensus CATAAGCGGCGGCGTCCGAAATCGCATCTCCGATCAGCATTCCTCCCAGCGCTCCACCTA
 
. : . : . : . : . : . :
rJMFF010K16- GTAACCCGGCGCCCAATCCTAACCCAAATTTGTTCTTCTTTGGCGGTTGTACCGGTGGAT
                      ____________________________________________________________
consensus GTAACCCGGCGCCCAATCCTAACCCAAATTTGTTCTTCTTTGGCGGTTGTACCGGTGGAT
 
. : . : . : . : . : . :
rJMFF010K16- ATCCGTATCCGGATTGCGATGGATATCCGTATCCGGGTTGCGGTGGATATCCGTATGCAG
                      ____________________________________________________________
consensus ATCCGTATCCGGATTGCGATGGATATCCGTATCCGGGTTGCGGTGGATATCCGTATGCAG
 
. : . : . : . : . : . :
rJMFF010K16- GAGGCGGAGGATGTGGATATCCACTACCATACGCCGCCGCAGCCGGCGGAGGCGGATATC
                      ____________________________________________________________
consensus GAGGCGGAGGATGTGGATATCCACTACCATACGCCGCCGCAGCCGGCGGAGGCGGATATC
 
. : . : . : . : . : . :
rJMFF010K16- CGTATCCGGCTGGAGGATACCCTACCGGCGGCGGATAGGCTGCTCCGCTAGCTGCCGGTC
                      ____________________________________________________________
consensus CGTATCCGGCTGGAGGATACCCTACCGGCGGCGGATAGGCTGCTCCGCTAGCTGCCGGTC
 
. : . : . : . : . : . :
rJMFF010K16- CATTGCGCGGTGGTGGTGTAGGACCTGGAGAATATACAGAGCTGCTTGAGCCCGGATAAG
JMFN009F16+ GCTGCTTGAGCCCGGATAAG
                      ____________________________________________________________
consensus CATTGCGCGGTGGTGGTGTAGGACCTGGAGAATATACAGAGCTGCTTGAGCCCGGATAAG
 
. : . : . : . : . : . :
rJMFF010K16- CCGGCGTAAAAGCCGGATAGGCCGTTACGGGTTCATCCACTTTATTCGCAGCCACCGCCG
JMFN009F16+ CCGGCGTAAAAGCCGGATAGGCCGTTACGGGTTCATCCACTTTATTCGCAGCCACCGCCG
                      ____________________________________________________________
consensus CCGGCGTAAAAGCCGGATAGGCCGTTACGGGTTCATCCACTTTATTCGCAGCCACCGCCG
 
. : . : . : . : . : . :
rJMFF010K16- CAATAGGCGGCGGGCCGTTAGTTTTCTCTCCGAACTGATAACAAAACGTCAGCTGACCTT
JMFN009F16+ CAATAGGCGGCGGGCCGTTAGTTTTCTCTCCGAACTGATAACAAAACGTCAGCTGACCTT
JMFF010K16+ GGCGGCGGGCCGTTAGTTTTCTCTCCGAACTGATAACAAAACGTCAGCTGACCTT
                      ____________________________________________________________
consensus CAATAGGCGGCGGGCCGTTAGTTTTCTCTCCGAACTGATAACAAAACGTCAGCTGACCTT
 
. : . : . : . : . : . :
rJMFF010K16- TCGGCTTTCCGGACGGCTTCTTCACCTGATAGTTCACGAACTGCTTCGTAGCCGATGCAG
JMFN009F16+ TCGGCTTTCCGGACGGCTTCTTCACCTGATAGTTCACGAACTGCTTCGTAGCCGATGCAG
JMFF010K16+ TCGGCTTTCCGGACGGCTTCTTCACCTGATAGTTCACGAACTGCTTCGTAGCCGATGCAG
                      ____________________________________________________________
consensus TCGGCTTTCCGGACGGCTTCTTCACCTGATAGTTCACGAACTGCTTCGTAGCCGATGCAG
 
. : . : . : . : . : . :
rJMFF010K16- CCGGAGAGTCGAGAAGCTCCTTAACAGGGACGATAACTTCACCGACGTCCCTATCCCCGA
JMFN009F16+ CCGGAGAGTCGAGAAGCTCCTTAACAGGGACGATAACTTCACCGACGTCCCTATCCCCGA
JMFF010K16+ CCGGAGAGTCGAGAAGCTCCTTAACAGGGACGATAACTTCACCGACGTCCCTATCCCCGA
                      ____________________________________________________________
consensus CCGGAGAGTCGAGAAGCTCCTTAACAGGGACGATAACTTCACCGACGTCCCTATCCCCGA
 
. : . : . : . : . : . :
rJMFF010K16- GAACGCGCTGGCAACGGAGCTTGAAAACGAGCATGANACGGCCCTGACGANCGGCGGCCT
JMFN009F16+ GAACGCGCTGGCAACGGAGCTTGAAAACGAGCATGAGACGGCCCTGACGAGCGGCGGCCT
JMFF010K16+ GAACGCGCTGGCAACGGAGCTTGAAAACGAGCATGAGACGGCCCTGACGAGCGGCGGCCT
                      ____________________________________________________________
consensus GAACGCGCTGGCAACGGAGCTTGAAAACGAGCATGAGACGGCCCTGACGAGCGGCGGCCT
 
. : . : . : . : . : . :
rJMFF010K16- CATCGACGGTGA
JMFN009F16+ CATCGACGGTGAACTTTACGGGGAAATTCCAGGCGGGGTTGGCCCCACCGTCGCGATCCA
JMFF010K16+ CATCGACGGTGAACTTTACGGGGAAATTCCAGGCGGGGTTGGCCCCACCGTCGCGATCCA
                      ____________________________________________________________
consensus CATCGACGGTGAACTTTACGGGGAAATTCCAGGCGGGGTTGGCCCCACCGTCGCGATCCA
 
. : . : . : . : . : . :
JMFN009F16+ CGGGAGTTTTGGACACCTGCTTGGATTTATCGTTGCCGCCGGAGATAGAAACGACGACGT
JMFF010K16+ CGGGAGTTTTGGACACCTGCTTGGATTTATCGTTGCCGCCGGAGATAGAAACGACGACGT
                      ____________________________________________________________
consensus CGGGAGTTTTGGACACCTGCTTGGATTTATCGTTGCCGCCGGAGATAGAAACGACGACGT
 
. : . : . : . : . : . :
JMFN009F16+ AAACATTCATCCTGGAGAAAACAGTGACCTTATTGAGATCTTTGGCCGACATAATCTTGA
JMFF010K16+ AAACATTCATCCTGGAGAAAACAGTGACCTTATTGAGATCTTTGGCCGACATAATCTTGA
                      ____________________________________________________________
consensus AAACATTCATCCTGGAGAAAACAGTGACCTTATTGAGATCTTTGGCCGACATAATCTTGA
 
. : . : . : . : . : . :
JMFN009F16+ TTTCCAAAGTACGAAACTCCATGGTTAAGCGATGGATGTTGGGGAAAGTAGCTAGCTTGT
JMFF010K16+ TTTCCAAAGTACGAAACTCCATGGTTAAGCGATGGATGTTGGGGAAAGTAGCTAGCTTGT
                      ____________________________________________________________
consensus TTTCCAAAGTACGAAACTCCATGGTTAAGCGATGGATGTTGGGGAAAGTAGCTAGCTTGT
 
. : . : . : . : . : . :
JMFN009F16+ TAGGGATTTATGTAGAGAGAAGCTAGAAGTGTGTGTAC
JMFF010K16+ TAGGGATTTATGTAGAGAGAAGCTAGAAGTGTGTGTACGCGAAGGTTTGAGAATGTATAT
                      ____________________________________________________________
consensus TAGGGATTTATGTAGAGAGAAGCTAGAAGTGTGTGTACGCGAAGGTTTGAGAATGTATAT