Previous Contig 000554:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010K14Sequence593000554 (4)pir|B85036|B850362e-45small nuclear riboprotein Sm-D1-like protein [imported] - Arabidopsis thaliana>g557000554 (4)pir|B85036|B850361e-45small nuclear riboprotein Sm-D1-like protein [imported] - Arabidopsis thaliana>g
JMFN011P09Sequence593000554 (4)pir|B85036|B850364e-44small nuclear riboprotein Sm-D1-like protein [imported] - Arabidopsis thaliana>g
JMFN046J17Sequence616000554 (4)pir|B85036|B850362e-45small nuclear riboprotein Sm-D1-like protein [imported] - Arabidopsis thaliana>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN046J17+ CAGATTATCATGTTTTTGACCCACTAAGTTCTAATTACT
                      ____________________________________________________________
consensus CAGATTATCATGTTTTTGACCCACTAAGTTCTAATTACT
 
. : . : . : . : . : . :
JMFN046J17+ AATTAGCAAAGCGATATACTAAAGAAAATCTCATAATCCACTCAAAGTAGTAACAGATTG
JMFF010K14+ CTAAAGAAAATCTCATAATCCACTCAAAGTAGTAACAGATTG
                      ____________________________________________________________
consensus AATTAGCAAAGCGATATACTAAAGAAAATCTCATAATCCACTCAAAGTAGTAACAGATTG
 
. : . : . : . : . : . :
JMFN046J17+ GCATCCATTCCATGCTATTAAACTACATAACGAGATAGACTCTCCATCATGAATACATGC
JMFF010K14+ GCATCCATTCCATGCTATTAAACTACATAACGAGATAGACTCTCCATCATGAATACATGC
                      ____________________________________________________________
consensus GCATCCATTCCATGCTATTAAACTACATAACGAGATAGACTCTCCATCATGAATACATGC
 
. : . : . : . : . : . :
JMFN046J17+ GTCTACATAAACAGATGTTGTCACAAAATGGGGAATGACTTAAAGGCCTTTACCGGCCTC
rJMFF010K14- CCTC
JMFN011P09+ CCTC
JMFF010K14+ GTCTACATAAACAGATGTTGTCACAAAATGGGGAATGACTTAAAGGCCTTTACCGGCCTC
                      ____________________________________________________________
consensus GTCTACATAAACAGATGTTGTCACAAAATGGGGAATGACTTAAAGGCCTTTACCGGCCTC
 
. : . : . : . : . : . :
JMFN046J17+ GCCCACGGCCACGCCCGCGTCCACGGCCCCGACCCCGGCCCATTGCCCTTCCAGCAGTTG
rJMFF010K14- GCCCACGGCCACGCCCGCGTCCACGGCCCCGACCCCGGCCCATTGCCCTTCCAGCAGTTG
JMFN011P09+ GCCCACGTCCACGCCCGCGCCCTCGTCCTCGGCCCCTCCCCATTGCCCGTCCAGCAGTGG
JMFF010K14+ GCCCACGGCCACGCCCGCGTCCACGGCCCCGACCCCGGCCCATTGCCCTTCCAGCAGTTG
                      ____________________________________________________________
consensus GCCCACGGCCACGCCCGCGTCCACGGCCCCGACCCCGGCCCATTGCCCTTCCAGCAGTTG
 
. : . : . : . : . : . :
JMFN046J17+ GCTTCTTAGGCTTCACTCTAGGAGTTTCTTCCACTAGCAAAGTCTCGAGATTTAAGCTAT
rJMFF010K14- GCTTCTTAGGCTTCACTCTAGGAGTTTCTTCCACTAGCAAAGTCTCGAGATTTAAGCTAT
JMFN011P09+ GCTTTTTTGGCTTCACCCTAGGTGTTTCTTCCACCAGCAAAGTCTCGAGATTTAAACTGT
JMFF010K14+ GCTTCTTAGGCTTCACTCTAGGAGTTTCTTCCACTAGCAAAGTCTCGAGATTTAAGCTAT
                      ____________________________________________________________
consensus GCTTCTTAGGCTTCACTCTAGGAGTTTCTTCCACTAGCAAAGTCTCGAGATTTAAGCTAT
 
. : . : . : . : . : . :
JMFN046J17+ CGGGGAGGATGTAATAGCGAATGTTGTTGCCCCTTACACTCAGGTGATCCATAGTCACAG
rJMFF010K14- CGGGGAGGATGTAATAGCGAATGTTGTTGCCCCTTACACTCAGGTGATCCATAGTCACAG
JMFN011P09+ CCGGCAGTATGTAATAACGAATGTTGTTACCCCTCACACTCAGGTGATCCATTGTCACGG
JMFF010K14+ CGGGGAGGATGTAATAGCGAATGTTGTTGCCCCTTACACTCAGGTGATCCATAGTCACAG
                      ____________________________________________________________
consensus CGGGGAGGATGTAATAGCGAATGTTGTTGCCCCTTACACTCAGGTGATCCATAGTCACAG
 
. : . : . : . : . : . :
JMFN046J17+ GATTTTTGCCTTTTGGAGTAAGCTTTACTGTCTTCAAGTGTGTGTTCATGCTGACATCAA
rJMFF010K14- GATTTTTGCCTTTTGGAGTAAGCTTTACTGTCTTCAAGTGTGTGTTCATGCTGACATCAA
JMFN011P09+ GATTCTTCCCTTTTGGTGTAAGCTTTACAGTCTTCAAGTGTGTGTTCATGCTGACATCAA
JMFF010K14+ GATTTTTGCCTTTTGGAGTAAGCTTTACTGTCTTCAAGTGTGTGTTCATGCTGACATCAA
                      ____________________________________________________________
consensus GATTTTTGCCTTTTGGAGTAAGCTTTACTGTCTTCAAGTGTGTGTTCATGCTGACATCAA
 
. : . : . : . : . : . :
JMFN046J17+ CACCTGTAATGGTTCCGTGAACAACGGTTCCGTTCTTGAGCTCAATCGAGACCGTCTCAT
rJMFF010K14- CACCTGTAATGGTTCCGTGAACAACGGTTCCGTTCTTGAGCTCAATCGAGACCGTCTCAT
JMFN011P09+ CACCAGTGATAGTTCCATGAACGACAGTGCCGTTTTTGAGCTCGATGGAGACAGTCTCAT
JMFF010K14+ CACCTGTAATGGTTCCGTGAACAACGGTTCCGTTCTTGAGCTCAATCGAGACCGTCTCAT
                      ____________________________________________________________
consensus CACCTGTAATGGTTCCGTGAACAACGGTTCCGTTCTTGAGCTCAATCGAGACCGTCTCAT
 
. : . : . : . : . : . :
JMFN046J17+ TGTTCAATTTCATCAAAAATCTGACAAGCTTCATCGTTGAGAGAG
rJMFF010K14- TGTTCAATTTCATCAAAAATCTGACAAGCTTCATCGTTGAGAGAG
JMFN011P09+ TGTTCAATTTCATCAAAAACCTGACGAGCTTCATCGTTGAGAGAG
JMFF010K14+ TGTTCAATTTCATCAAAAATCTGACAAGCTTCATCGTTGAGAGAGTAAGAACAGAGAAGC
                      ____________________________________________________________
consensus TGTTCAATTTCATCAAAAATCTGACAAGCTTCATCGTTGAGAGAGTAAGAACAGAGAAGC
 
. : . : . : . : . : . :
JMFF010K14+ TAGGGCTATGTCGAAGCGATAGAGCGCAAAAGCCTCTTCAGTCTGGAAGACGGGGTTTTT
                      ____________________________________________________________
consensus TAGGGCTATGTCGAAGCGATAGAGCGCAAAAGCCTCTTCAGTCTGGAAGACGGGGTTTTT