Previous Contig 000547:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H18Sequence578000547 (2)pir|C84425|C844252e-43similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian729011850 (3)pir|C84425|C844254e-27similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian
JMSF015M22Sequence450000547 (2)pir|C84425|C844252e-22similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian741011850 (3)pir|C84425|C844252e-28similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF010H18+ ATTCAGGTAAACCTCCAGATGACTTGTTTGCGCATGGT
                      ____________________________________________________________
consensus ATTCAGGTAAACCTCCAGATGACTTGTTTGCGCATGGT
 
. : . : . : . : . : . :
JMFF010H18+ CTCCATTCATCACCTTTATAAGAGTGTTTCCATATCGTTGATATCGCATCGGCGGATGAA
                      ____________________________________________________________
consensus CTCCATTCATCACCTTTATAAGAGTGTTTCCATATCGTTGATATCGCATCGGCGGATGAA
 
. : . : . : . : . : . :
JMSF015M22+ TGAGGTATAGTTGAGGGCTGCGGTAGATGGAG
JMFF010H18+ TTGTCGGAATCCATCTCGGGTTGAAGTTTGAGGTATAGTTGAGGGCTGCGGTAGATGGAG
                      ____________________________________________________________
consensus TTGTCGGAATCCATCTCGGGTTGAAGTTTGAGGTATAGTTGAGGGCTGCGGTAGATGGAG
 
. : . : . : . : . : . :
JMSF015M22+ CCAGGAGTGGCTCGGTGCTTGATGATAGGCACAGCATCGAACGACACCGTCCCCATGTAG
JMFF010H18+ CCAGGAGTGGCTCGGTGCTTGATGATAGGCACAGCATCGAACGACACCGTCCCCATGTAG
                      ____________________________________________________________
consensus CCAGGAGTGGCTCGGTGCTTGATGATAGGCACAGCATCGAACGACACCGTCCCCATGTAG
 
. : . : . : . : . : . :
JMSF015M22+ AAGAGCATGCCGGAGATGTAAAGCAAGGGCGCGAAAAGAAAGATGCCCTGGCGGCGGAGG
JMFF010H18+ AAGAGCATGCCGGAGATGTAAAGCAAGGGCGCGAAAAGAAAGATGCCCTGGCGGCGGAGG
                      ____________________________________________________________
consensus AAGAGCATGCCGGAGATGTAAAGCAAGGGCGCGAAAAGAAAGATGCCCTGGCGGCGGAGG
 
. : . : . : . : . : . :
JMSF015M22+ AGGACGGAGAGGAGGATCCAGGCGAAGCGTTGCGCGAGGGTTCTTGGGGCGGGTTGACCC
JMFF010H18+ AGGACGGAGAGGAGGATCCAGGCGAAGCGTTGCGCGAGGGTTCTTGGGGCGGGTTGACCC
                      ____________________________________________________________
consensus AGGACGGAGAGGAGGATCCAGGCGAAGCGTTGCGCGAGGGTTCTTGGGGCGGGTTGACCC
 
. : . : . : . : . : . :
JMSF015M22+ GGAGTGAAGCGACCGCCGGGTTTTCCGCCGCGGCGGACCCGAGGCGACCGAGAGCGCGGC
JMFF010H18+ GGAGTGAAGCGACCGCCGGGTTTTCCGCCGCGGCGGACCCGAGGCGACCGAGAGCGCGGC
                      ____________________________________________________________
consensus GGAGTGAAGCGACCGCCGGGTTTTCCGCCGCGGCGGACCCGAGGCGACCGAGAGCGCGGC
 
. : . : . : . : . : . :
JMSF015M22+ GACGACGGCGTTGAGGGGCTGCTGTGTCCGCTGCTCGGTAGCCTATTCTTCGCGTGCATG
JMFF010H18+ GACGACGGCGTTGAGGGGCTGCTGTGTCCGCTGCTCGGTAGCCTATTCTTCGCGTGCATG
                      ____________________________________________________________
consensus GACGACGGCGTTGAGGGGCTGCTGTGTCCGCTGCTCGGTAGCCTATTCTTCGCGTGCATG
 
. : . : . : . : . : . :
JMSF015M22+ TCTCCTATACTTCACATCATTCTTAGTACATATATACAACAATCTTGAAAACCCAATACG
JMFF010H18+ TCTCCTATACTTCACATCATTCTTAGTACATATATACAACAATCTTGAAAACCCAATACG
                      ____________________________________________________________
consensus TCTCCTATACTTCACATCATTCTTAGTACATATATACAACAATCTTGAAAACCCAATACG
 
. : . : . : . : . : . :
JMSF015M22+ ACGAAAAATTCCAAAAATCCAAAATCTTCTTCCCCTCTCTCTCTCCCCTCTCAAA
JMFF010H18+ ACGAAAAATTCCAAAAATCCAAAATCTTCTTCCCCTCTCTCTCTCCCCTCTCAAATGAGT
                      ____________________________________________________________
consensus ACGAAAAATTCCAAAAATCCAAAATCTTCTTCCCCTCTCTCTCTCCCCTCTCAAATGAGT