Previous Contig 000545:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H06Sequence492000545 (2)pir|F85091|F850913e-28hypothetical protein AT4g09060 [imported] - Arabidopsis thaliana>gb:ATCHRIV26_15763008646 (2)pir|F85091|F850917e-22hypothetical protein AT4g09060 [imported] - Arabidopsis thaliana>gb:ATCHRIV26_15
JMFF035A19Sequence532000545 (2)pir|F85091|F850914e-34hypothetical protein AT4g09060 [imported] - Arabidopsis thaliana>gb:ATCHRIV26_15759008646 (2)pir|F85091|F850917e-22hypothetical protein AT4g09060 [imported] - Arabidopsis thaliana>gb:ATCHRIV26_15

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF035A19+ TCCGCCTCATTCCCAAAATCCATCAATGCCTCTCGGTCACGGTCGTACAACG
JMFF010H06+ GGTCGTACAACG
                      ____________________________________________________________
consensus TCCGCCTCATTCCCAAAATCCATCAATGCCTCTCGGTCACGGTCGTACAACG
 
. : . : . : . : . : . :
JMFF035A19+ AGCACTCTCTCTCCCATCTCTTGCACTGCGCCAACAAATTCGAGCACTCCACCGCCAGTC
JMFF010H06+ AGCACTCTCTCTCCCATCTCTTGCACTGCGCCAACAAATTCGAGCACTCCACCGCCAGTC
                      ____________________________________________________________
consensus AGCACTCTCTCTCCCATCTCTTGCACTGCGCCAACAAATTCGAGCACTCCACCGCCAGTC
 
. : . : . : . : . : . :
JMFF035A19+ TCTGATTCTCCTCCACGAACTTCTTCAACGCAGCCGCATTCATACTCGCCTCAGCCCTAG
JMFF010H06+ TCTGATTCTCCTCCACGAACTTCTTCAACGCAGCCGCATTCATACTCGCCTCAGCCCTAG
                      ____________________________________________________________
consensus TCTGATTCTCCTCCACGAACTTCTTCAACGCAGCCGCATTCATACTCGCCTCAGCCCTAG
 
. : . : . : . : . : . :
JMFF035A19+ TGCGCTCAACGACGTCATCCTTTTCTTTTAGTTTCGATTGCAAGAAAAGACAGTGATTGC
JMFF010H06+ TGCGCTCAACGACGTCATCCTTTTCTTTTAGTTTCGATTGCAAGAAAAGACAGTGATTGC
                      ____________________________________________________________
consensus TGCGCTCAACGACGTCATCCTTTTCTTTTAGTTTCGATTGCAAGAAAAGACAGTGATTGC
 
. : . : . : . : . : . :
JMFF035A19+ GGAGCAGGAGAAGTGATTGTTCGGACGCTTGAAGCTTCAATTGAAGAGTTTGAGTCGAGA
JMFF010H06+ GGAGCAGGAGAAGTGATTGTTCGGACGCTTGAAGCTTCAATTGAAGAGTTTGAGTCGAGA
                      ____________________________________________________________
consensus GGAGCAGGAGAAGTGATTGTTCGGACGCTTGAAGCTTCAATTGAAGAGTTTGAGTCGAGA
 
. : . : . : . : . : . :
JMFF035A19+ CGGGGAGGCCAAGAGTGTGCTCGATCGATTCTCGAATATAATCATCAGTTTCACGAGAAA
JMFF010H06+ CGGGGAGGCCAAGAGTGTGCTCGATCGATTCTCGAATATAATCATCAGTTTCACGAGAAA
                      ____________________________________________________________
consensus CGGGGAGGCCAAGAGTGTGCTCGATCGATTCTCGAATATAATCATCAGTTTCACGAGAAA
 
. : . : . : . : . : . :
JMFF035A19+ TCTCCATCTTTTTTACTGAACTTCCAAAAATCCAGAAGAATCTATCACCAGAGAAATTCG
JMFF010H06+ TCTCCATCTTTTTTACTGAACTTCCAAAAATCCAGAAGAATCTATCACCAGAGAAATTCG
                      ____________________________________________________________
consensus TCTCCATCTTTTTTACTGAACTTCCAAAAATCCAGAAGAATCTATCACCAGAGAAATTCG
 
. : . : . : . : . : . :
JMFF035A19+ AAGCGCCGAACAATCTCAATGAGTGAGGAATGCGAGAGAGGTGGGGCTGATCGGAAACTG
JMFF010H06+ AAGCGCCGAACAATCTCAATGAGTGAGGAATGCGAGAGAGGTGGGGCTGATCGGAAACTG
                      ____________________________________________________________
consensus AAGCGCCGAACAATCTCAATGAGTGAGGAATGCGAGAGAGGTGGGGCTGATCGGAAACTG
 
. : . : . : . : . : . :
JMFF035A19+ GGATTTTGGGTCTGCTCAGAAAAGATTGGAAAATTTTTTGAGATTTCAAATTGGGGAAGT
JMFF010H06+ GGATTTTGGGTCTGCTCAGAAAAGATTGGAAAATTTTTTGAGATTTCAAATTGGGGAAGT
                      ____________________________________________________________
consensus GGATTTTGGGTCTGCTCAGAAAAGATTGGAAAATTTTTTGAGATTTCAAATTGGGGAAGT