Previous Contig 000532:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010A15Sequence542000532 (8)gb:AY034946_15597281e-41Arabidopsis thaliana unknown protein (At5g13190) mRNA, complete cds.>gb:AY062988715020865gb:AY034946_15597282e-47Arabidopsis thaliana unknown protein (At5g13190) mRNA, complete cds.>gb:AY062988
JMFF031M13Sequence567000532 (8)gb:AY034946_15597282e-54Arabidopsis thaliana unknown protein (At5g13190) mRNA, complete cds.>gb:AY062988591000532 (8)gb:AY034946_15597283e-55Arabidopsis thaliana unknown protein (At5g13190) mRNA, complete cds.>gb:AY062988
JMSF023L15Sequence680000532 (8)gb:AY034946_15597282e-54Arabidopsis thaliana unknown protein (At5g13190) mRNA, complete cds.>gb:AY062988
JMSF028L05Sequence669000532 (8)gb:AY034946_15597282e-54Arabidopsis thaliana unknown protein (At5g13190) mRNA, complete cds.>gb:AY062988625000532 (8)gb:AY034946_15597283e-55Arabidopsis thaliana unknown protein (At5g13190) mRNA, complete cds.>gb:AY062988
JMSF041O08Sequence766000532 (8)gb:AY034946_15597283e-54Arabidopsis thaliana unknown protein (At5g13190) mRNA, complete cds.>gb:AY062988730000532 (8)gb:AY034946_15597283e-54Arabidopsis thaliana unknown protein (At5g13190) mRNA, complete cds.>gb:AY062988

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041O08+ AACAATCCAAATTATT
                      ____________________________________________________________
consensus AACAATCCAAATTATT
 
. : . : . : . : . : . :
JMSF023L15+ ACTTGAACACAA
rJMSF041O08- ATAGCATTTTACATTTACATGGTAAGAACTTGAACACAA
JMSF041O08+ ATTCTCTATATATAAATAGTAATAGCATTTTACATTTACAT-GTAAGAACTTGAACACAA
                      ____________________________________________________________
consensus ATTCTCTATATATAAATAGTAATAGCATTTTACATTTACATGGTAAGAACTTGAACACAA
 
. : . : . : . : . : . :
rJMFF031M13- ATATAACTCGGGATTGA
JMSF023L15+ CAAGCACTTTATGTATCACTCACTGAGCAAATAACGCACTTCAATATAACTCGGGATTGA
rJMSF041O08- CAAGCACTTTATGTATCACTCACTGAGCAAATAACGCACTTCAATATAACTCGGGATTGA
JMSF041O08+ CAAGCACTTTATGTATCACTCACTGAGCAAATAACGCACTTCAATATAACTCGGGATTGA
JMSF028L05+ TGAGCAAATAACGCACTTCAATATAACTCGGGATTGA
                      ____________________________________________________________
consensus CAAGCACTTTATGTATCACTCACTGAGCAAATAACGCACTTCAATATAACTCGGGATTGA
 
. : . : . : . : . : . :
rJMFF031M13- TTCTGTACCATATTTAACAAAAACTTATGTAAAGAACACAGCTGGAGAGTATATCAGTTC
JMSF023L15+ TTCTGTACCATATTTAACAAAAACTTATGTAAAGAACACAGCTGGAGAGTATATCAGTTC
rJMSF041O08- TTCTGTACCATATTTAACAAAAACTTATGTAAAGAACACAGCTGGAGAGTATATCAGTTC
rJMSF028L05- CCATATTTAACAAAAACTTATGTAAAGAACACAGCTGGAGAGTATATCAGTTC
JMSF041O08+ TTCTGTACCATATTTAACAAAAACTTATGTAAAGAACACAGCTGGAGAGTATATCAGTTC
JMSF028L05+ TTCTGTACCATATTTAACAAAAACTTATGTAAAGAACACAGCTGGAGAGTATATCAGTTC
                      ____________________________________________________________
consensus TTCTGTACCATATTTAACAAAAACTTATGTAAAGAACACAGCTGGAGAGTATATCAGTTC
 
. : . : . : . : . : . :
rJMFF031M13- ATCAACCAGAAAAGAATACTTGATACTACTATGTATGGAGTGGCAATTCAATACAATGGA
JMSF023L15+ ATCAACCAGAAAAGAATACTTGATACTACTATGTATGGAGTGGCAATTCAATACAATGGA
JMFF031M13+ TCAACCAGAAAAGAATACTTGATACTACTATGTATGGAGTGGCAATTCAATACAATGGA
rJMSF041O08- ATCAACCAGAAAAGAATACTTGATACTACTATGTATGGAGTGGCAATTCAATACAATGGA
rJMSF028L05- ATCAACCAGAAAAGAATACTTGATACTACTATGTATGGAGTGGCAATTCAATACAATGGA
JMSF041O08+ ATCAACCAGAAAAGAATACTTGATACTACTATGTATGGAGTGGCAATTCAATACAATGGA
JMSF028L05+ ATCAACCAGAAAAGAATACTTGATACTACTATGTATGGAGTGGCAATTCAATACAATGGA
                      ____________________________________________________________
consensus ATCAACCAGAAAAGAATACTTGATACTACTATGTATGGAGTGGCAATTCAATACAATGGA
 
. : . : . : . : . : . :
rJMFF031M13- ATACGGGCAGCAATTGCTTATCGATCAGGCAGGTAGTGCAAAACTTAGTTCTTTCCACTG
JMSF023L15+ ATACGGGCAGCAATTGCTTATCGATCAGGCAGGTAGTGCAAAACTTAGTTCTTTCCACTG
JMFF031M13+ ATACGGGCAGCAATTGCTTATCGATCAGGCAGGTAGTGCAAAACTTAGTTCTTTCCACTG
rJMSF041O08- ATACGGGCAGCAATTGCTTATCGATCAGGCAGGTAGTGCAAAACTTAGTTCTTTCCACTG
rJMSF028L05- ATACGGGCAGCAATTGCTTATCGATCAGGCAGGTAGTGCAAAACTTAGTTCTTTCCACTG
JMSF041O08+ ATACGGGCAGCAATTGCTTATCGATCAGGCAGGTAGTGCAAAACTTAGTTCTTTCCACTG
JMSF028L05+ ATACGGGCAGCAATTGCTTATCGATCAGGCAGGTAGTGCAAAACTTAGTTCTTTCCACTG
                      ____________________________________________________________
consensus ATACGGGCAGCAATTGCTTATCGATCAGGCAGGTAGTGCAAAACTTAGTTCTTTCCACTG
 
. : . : . : . : . : . :
rJMFF031M13- CGGAGGGTCCACCACTATACAAGGATCAGACTTCTCAAAGTCGGCAACTTTCTCATTGCA
JMSF023L15+ CGGAGGGTCCACCACTATACAAGGATCAGACTTCTCAAAGTCGGCAACTTTCTCATTGCA
JMFF031M13+ CGGAGGGTCCACCACTATACAAGGATCAGACTTCTCAAAGTCGGCAACTTTCTCATTGCA
rJMSF041O08- CGGAGGGTCCACCACTATACAAGGATCAGACTTCTCAAAGTCGGCAACTTTCTCATTGCA
rJMSF028L05- CGGAGGGTCCACCACTATACAAGGATCAGACTTCTCAAAGTCGGCAACTTTCTCATTGCA
JMSF041O08+ CGGAGGGTCCACCACTATACAAGGATCAGACTTCTCAAAGTCGGCAACTTTCTCATTGCA
JMSF028L05+ CGGAGGGTCCACCACTATACAAGGATCAGACTTCTCAAAGTCGGCAACTTTCTCATTGCA
JMFF010A15+ ACTTTCTCATTGCA
                      ____________________________________________________________
consensus CGGAGGGTCCACCACTATACAAGGATCAGACTTCTCAAAGTCGGCAACTTTCTCATTGCA
 
. : . : . : . : . : . :
rJMFF031M13- GCTTGGACAGTAGTGATATTTATGCCAAAGGCAATCCATTGAGGGGCAGAGAAAGCAAAC
JMSF023L15+ GCTTGGACAGTAGTGATATTTATGCCAAAGGCAATCCATTGAGGGGCAGAGAAAGCAAAC
JMFF031M13+ GCTTGGACAGTAGTGATATTTATGCCAAAGGCAATCCATTGAGGGGCAGAGAAAGCAAAC
rJMSF041O08- GCTTGGACAGTAGTGATATTTATGCCAAAGGCAATCCATTGAGGGGCAGAGAAAGCAAAC
rJMSF028L05- GCTTGGACAGTAGTGATATTTATGCCAAAGGCAATCCATTGAGGGGCAGAGAAAGCAAAC
JMSF041O08+ GCTTGGACAGTAGTGATATTTATGCCAAAGGCAATCCATTGAGGGGCAGAGAAAGCAAAC
JMSF028L05+ GCTTGGACAGTAGTGATATTTATGCCAAAGGCAATCCATTGAGGGGCAGAGAAAGCAAAC
JMFF010A15+ GCTTGGACAGTAGTGATATTTATGCCAAAGGCAATCCATTGAGGGGCAGAGAAAGCAAAC
                      ____________________________________________________________
consensus GCTTGGACAGTAGTGATATTTATGCCAAAGGCAATCCATTGAGGGGCAGAGAAAGCAAAC
 
. : . : . : . : . : . :
rJMFF031M13- CCCAAGCATCATTGGCATCATACACCCAACACAAGCTGCCAAACTTGGTTTCGACTTGAC
JMSF023L15+ CCCAAGCATCATTGGCATCATACACCCAACACAAGCTGCCAAACTTGGTTTCGACTTGAC
JMFF031M13+ CCCAAGCATCATTGGCATCATACACCCAACACAAGCTGCCAAACTTGGTTTCGACTTGAC
rJMSF041O08- CCCAAGCATCATTGGCATCATACACCCAACACAAGCTGCCAAACTTGGTTTCGACTTGAC
rJMSF028L05- CCCAAGCATCATTGGCATCATACACCCAACACAAGCTGCCAAACTTGGTTTCGACTTGAC
JMSF041O08+ CCCAAGCATCATTGGCATCATACACCCAACACAAGCTGCCAAACTTGGTTTCGACTTGAC
JMSF028L05+ CCCAAGCATCATTGGCATCATACACCCAACACAAGCTGCCAAACTTGGTTTCGACTTGAC
JMFF010A15+ CCCAAGCATCATTGGCATCATACACCCAACACAAGCTGCCAAACTTGGTTTCGACTTGAC
                      ____________________________________________________________
consensus CCCAAGCATCATTGGCATCATACACCCAACACAAGCTGCCAAACTTGGTTTCGACTTGAC
 
. : . : . : . : . : . :
rJMFF031M13- AAGGGTAAGTCCAGAATTGCCACAGTGGATGCAGTTGAAGGGTGCCGGAGTGTCGCGGTA
JMSF023L15+ AAGGGTAAGTCCAGAATTGCCACAGTGGATGCAGTTGAAGGGTGCCGGAGTGTCGCGGTA
JMFF031M13+ AAGGGTAAGTCCAGAATTGCCACAGTGGATGCAGTTGAAGGGTGCCGGAGTGTCGCGGTA
rJMSF041O08- AAGGGTAAGTCCAGAATTGCCACAGTGGATGCAGTTGAAGGGTGCCGGAGTGTCGCGGTA
rJMSF028L05- AAGGGTAAGTCCAGAATTGCCACAGTGGATGCAGTTGAAGGGTGCCGGAGTGTCGCGGTA
JMSF041O08+ AAGGGTAAGTCCAGAATTGCCACAGTGGATGCAGTTGAAGGGTGCCGGAGTGTCGCGGTA
JMSF028L05+ AAGGGTAAGTCCAGAATTGCCACAGTGGATGCAGTTGAAGGGTGCCGGAGTGTCGCGGTA
JMFF010A15+ AAGGGTAAGTCCAGAATTGCCACAGTGGATGCAGTTGAAGGGTGCCGGAGTGTCGCGGTA
                      ____________________________________________________________
consensus AAGGGTAAGTCCAGAATTGCCACAGTGGATGCAGTTGAAGGGTGCCGGAGTGTCGCGGTA
 
. : . : . : . : . : . :
rJMFF031M13- CATAGTCTGCTGAATCGGAATTCCTTTGGGGTCTCCGACGATGGCGTTCGGAGGGATGAC
JMSF023L15+ CATAGTCTGCTGAATCGGAATTCCTTTGGGGTCTCCGACGATGGCGTTCGGAGGGATGAC
JMFF031M13+ CATAGTCTGCTGAATCGGAATTCCTTTGGGGTCTCCGACGATGGCGTTCGGAGGGATGAC
rJMSF041O08- CATAGTCTGCTGAATCGGAATTCCTTTGGGGTCTCCGACGATGGCGTTCGGAGGGATGAC
rJMSF028L05- CATAGTCTGCTGAATCGGAATTCCTTTGGGGTCTCCGACGATGGCGTTCGGAGGGATGAC
JMSF041O08+ CATAGTCTGCTGAATCGGAATTCCTTTGGGGTCTCCGACGATGGCGTTCGGAGGGATGAC
JMSF028L05+ CATAGTCTGCTGAATCGGAATTCCTTTGGGGTCTCCGACGATGGCGTTCGGAGGGATGAC
JMFF010A15+ CATAGTCTGCTGAATCGGAATTCCTTTGGGGTCTCCGACGATGGCGTTCGGAGGGATGAC
                      ____________________________________________________________
consensus CATAGTCTGCTGAATCGGAATTCCTTTGGGGTCTCCGACGATGGCGTTCGGAGGGATGAC
 
. : . : . : . : . : . :
rJMFF031M13- GCCAGCTTGGTAAGGGTTTTCTTGAACAAAGTACTGCGGATGCTGCGGTGGGCGGCGCCG
JMSF023L15+ GCCAGCTTGGTAAGGGTTTTCTTGAACAAAGTACTGCGGATGCTGCGGTGG-CGGCGCCG
JMFF031M13+ GCCAGCTTGGTAAGGGTTTTCTTGAACAAAGTACTGCGGATGCTGCGGTGG-CGGCGCCG
rJMSF041O08- GCCAGCTTGGTAAGGGTTTTCTTGAACAAAGTACTGCGGATGCTGCGGTGG-CGGCGCCG
rJMSF028L05- GCCAGCTTGGTAAGGGTTTTCTTGAACAAAGTACTGCGGATGCTGCGGTGGCCGGCGCCG
JMSF041O08+ GCCAGCTTGGTAAGGGTTTTCTTGAACAAAGTACTGCGGATGCTGCGGTGG-CGGCGCCG
JMSF028L05+ GCCAGCTTGGTAAGGGTTTTCTTGAACAAAGTACTGCGGATGCTGCGGTGG-CGGCGCCG
JMFF010A15+ GCCAGCTTGGTAAGGGTTTTCTTGAACAAAGTACTGCGGATGCTGCGGTGG-CGGCGCCG
                      ____________________________________________________________
consensus GCCAGCTTGGTAAGGGTTTTCTTGAACAAAGTACTGCGGATGCTGCGGTGG-CGGCGCCG
 
. : . : . : . : . : . :
rJMFF031M13- GCGCCGGCGCCGGCGCCTGATAGGCC-GGATTATA
JMSF023L15+ GCGCCGGCGCCGGCGCCTGATAGGCC-GGATTATAGGGGATTCCGATAGCTGGTTCCTCG
JMFF031M13+ GCGCCGGCGCCGGCGCCTGATAGGCC-GGATTATAGGGGATTCCGATAGCTGGTTCCTCG
rJMSF041O08- GCGCCGGCGCCGGCGCCTGATAGGCC-GGATTATAGGGGATTCCGATAGCTGGTTCCTCG
rJMSF028L05- GCGCCGGCGCCGGCGCCTGATAGGCC-GGATTATAGGGGATTCCGATAGCTGGTTCCTCG
JMSF041O08+ GCGCCGGCGCCGGCGCCTGATAGGCC-GGATTATAGGGGATTCCGATAGCTGGTTCCTCG
JMSF028L05+ GCGCCGGCGCCGGCGCCTGATAGGCC-GGATTATAGGGGATTCCGATAGCTGGTTCCTCG
JMFF010A15+ GCGCCGGCGCCGGCGCCTGATAGGCCGGGATTATAGGGGATTCCGATAGCTGGTTCCTCG
                      ____________________________________________________________
consensus GCGCCGGCGCCGGCGCCTGATAGGCC-GGATTATAGGGGATTCCGATAGCTGGTTCCTCG
 
. : . : . : . : . : . :
JMSF023L15+ GTCTTCGAC
JMFF031M13+ GTCTTCGACATTGCATACGATTCAATTCTC
rJMSF041O08- GTCTTCGACATTGCATACGATTCAATTCTCAGC
rJMSF028L05- GTCTTCGACATTGCATACGATTCAATTCTCAGC
JMSF041O08+ GTCTTCGACATTGCATACGATTCAATTCTCAGC
JMSF028L05+ GTCTTCGACATTGCATACGATTCAATTCTCAGC
JMFF010A15+ GTCTTCGACATTGCATACGATTCAATTCTCAGGAAGATCTCTCTCGCTGGCGCGTACTAT
                      ____________________________________________________________
consensus GTCTTCGACATTGCATACGATTCAATTCTCAGCAAGATCTCTCTCGCTGGCGCGTACTAT