Previous Contig 000530:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010A06Sequence222000530 (3)pir|T02667|T026674e-06proteinase inhibitor - rice>gb:OSU72942_1698503 Oryza sativa proteinase inhibito355000530 (3)gb:AY552546_16134001e-07Ipomoea batatas Kunitz-type trypsin inhibitor mRNA, complete cds.
JMFF010B06Sequence357000530 (3)gb:AY552546_16134003e-13Ipomoea batatas Kunitz-type trypsin inhibitor mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010A06+ CTCATCCTCTGCAGCAAAACATGGCTTCATCTCT
rJMFF010B06+ GCAAAACATGGCTTCATCTCT
                      ____________________________________________________________
consensus CTCATCCTCTGCAGCAAAACATGGCTTCATCTCT
 
. : . : . : . : . : . :
rJMFF010A06+ CCGTTCATTTGCAGCTGCCCTTCTCTTTGTCATGCTGTTCATGGCCACTGAGCTGGGGAG
rJMFF010B06+ CCGTTCATTTGCAGCTGCCCTTCTCTTTGTCATGCTGTTCATGNCCNCTGAGNTGGGGAG
                      ____________________________________________________________
consensus CCGTTCATTTGCAGCTGCCCTTCTCTTTGTCATGCTGTTCATGGCCACTGAGCTGGGGAG
 
. : . : . : . : . : . :
rJMFF010A06+ AAACACAATATTGGTGGCAGAGGCAGGGAAGTGCGAGGTGCCGAGCGGCAAGTTCAAGGG
rJMFF010B06+ AANCACAATATTGGTGGCAGAGGCAGGGAAGTGCGAGGTGCCGAGCGGCAAGTTCAAGGG
                      ____________________________________________________________
consensus AAACACAATATTGGTGGCAGAGGCAGGGAAGTGCGAGGTGCCGAGCGGCAAGTTCAAGGG
 
. : . : . : . : . : . :
rJMFF010A06+ GTTATGTGGTCGGAGCAAAACCTGCAGATCGATTTGCCGGACGGAGGTGTTNNCCGACGN
rJMFF010B06+ GTTATGTGGTCGGAGCAAAACCTGCAGATCGATTTGCCGGACGGAGGTGTNNNCCGACG-
JMFF010A06- AAACCTGCAGATCGATTTGCCGGACGGAGGGGTTCCCCGACG-
                      ____________________________________________________________
consensus GTTATGTGGTCGGAGCAAAACCTGCAGATCGATTTGCCGGACGGAGGTGTTCCCCGACG-
 
. : . : . : . : . : . :
rJMFF010A06+ GCCAGTGCAGAGGGATTAGGTTCCGCTGCATGTGCATTAAGAATTGCTAATTCATCGATC
rJMFF010B06+ GCCAGTGCAGAGGGATTAGGTTCCGCTGCATGTGCATTAAGAATTGCTAATTCATCGATC
JMFF010A06- GCCAGTGCAGAGGGATTAGGTTCCGCTGCATGTGCATTAAGAATTGCTAATTCATCGATC
                      ____________________________________________________________
consensus GCCAGTGCAGAGGGATTAGGTTCCGCTGCATGTGCATTAAGAATTGCTAATTCATCGATC
 
. : . : . : . : . : . :
rJMFF010A06+ TAAGCTACCGATAAATGTTACAAATCCAACGACCCATGGAGCCTTGGCTTCTCTCTGATC
rJMFF010B06+ TAAGCTACCGATAAATGTTACAAATCCAACGACCCATGGAGCCTTGGCTTCTCTCTGATC
JMFF010A06- TAAGCTACCGATAAATGTTACAAATCCAACGACCCATGGAGCCTTGGCTTCTCTCTGATC
                      ____________________________________________________________
consensus TAAGCTACCGATAAATGTTACAAATCCAACGACCCATGGAGCCTTGGCTTCTCTCTGATC
 
. : . : . : . : . : . :
rJMFF010A06+ TTCTTGTTAAATTTTAAGCGC
rJMFF010B06+ TTCTTGTTAAATTTTAAGCGC
JMFF010A06- TTCTTGTTAAATTTTAAGCGCCGTTGAAAGTTGGTTTTAATGGTTATATGAAAAAAAAAA
                      ____________________________________________________________
consensus TTCTTGTTAAATTTTAAGCGCCGTTGAAAGTTGGTTTTAATGGTTATATGAAAAAAAAAA