Previous Contig 000529:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009P22Sequence583000529 (2)pir|E96718|E967182e-54probable cullin T6C23.13 [imported] - Arabidopsis thaliana>gb:AE005173_894551 Ar767010685 (3)gb:AP004114_18377959e-89Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMFS016G01Sequence579000529 (2)pir|E96718|E967182e-14probable cullin T6C23.13 [imported] - Arabidopsis thaliana>gb:AE005173_894551 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS016G01+ TAAG
                      ____________________________________________________________
consensus TAAG
 
. : . : . : . : . : . :
JMFS016G01+ TGAAATTAAGCTCTCTCTTCTTTTTTTTTTTTTCAAAAGCACATGATTGTTATCCAAATA
                      ____________________________________________________________
consensus TGAAATTAAGCTCTCTCTTCTTTTTTTTTTTTTCAAAAGCACATGATTGTTATCCAAATA
 
. : . : . : . : . : . :
JMFS016G01+ AAAAGGGGGACCTCATTTCTTCAAATCCATCGTTCAGAATTCCAAGTTGTAGCAGCATCA
                      ____________________________________________________________
consensus AAAAGGGGGACCTCATTTCTTCAAATCCATCGTTCAGAATTCCAAGTTGTAGCAGCATCA
 
. : . : . : . : . : . :
JMFS016G01+ AATTTCATGTGTTTACCATTCTTGGATATCAAAATCAGATACAGAACAAGTATAAAGTGT
                      ____________________________________________________________
consensus AATTTCATGTGTTTACCATTCTTGGATATCAAAATCAGATACAGAACAAGTATAAAGTGT
 
. : . : . : . : . : . :
JMFS016G01+ ATAGGCAAATGAGTTAAACGAAAAAGCACTCCAAACCTATAGAGCTCTTCAAAACTAAGG
JMFF009P22+ CCTATAGAGCTCTTCAAAACTAAGG
                      ____________________________________________________________
consensus ATAGGCAAATGAGTTAAACGAAAAAGCACTCCAAACCTATAGAGCTCTTCAAAACTAAGG
 
. : . : . : . : . : . :
JMFS016G01+ CCACTGGCGTTATGATTGTAAATCTCGTGAATCGCATGTTCAATGATATTCCAGGTCTTC
JMFF009P22+ CCACTGGCGTTATGATTGTAAATCTCGTGAATCGCATGTTCAATGATATTCCAGGTCTTC
                      ____________________________________________________________
consensus CCACTGGCGTTATGATTGTAAATCTCGTGAATCGCATGTTCAATGATATTCCAGGTCTTC
 
. : . : . : . : . : . :
JMFS016G01+ TCTGCAACTCACAGTATCAACCACGACCCGATGCTTAAACGCCTCTATCTGAAAATTCCT
JMFF009P22+ TCTGCATATTTCGG-ATCAACCACGACCCGATGCTTAAACGCCTCTATCTGAAAATTCCT
                      ____________________________________________________________
consensus TCTGCATCTTTCGGTATCAACCACGACCCGATGCTTAAACGCCTCTATCTGAAAATTCCT
 
. : . : . : . : . : . :
JMFS016G01+ CTTCTTCGGCGCACTCATTTCTCGCTTAAACTGTCCACCGCTTCGGAACCCGACTCCTCG
JMFF009P22+ CTTCTTCGGCGCACTCATTTCTCGCTTAAACTGTCCACCGCTTCGGAACCCGACTCCTCG
                      ____________________________________________________________
consensus CTTCTTCGGCGCACTCATTTCTCGCTTAAACTGTCCACCGCTTCGGAACCCGACTCCTCG
 
. : . : . : . : . : . :
JMFS016G01+ GCCGTGCCCGCACCCGTGACTCCAGAACTCAAATCTCACCGACGGGTAACTATCGATCTG
JMFF009P22+ GCCGTGCCCGCACCCGTGACTCCAGAACTCAAATCTCACCGACGGGTAACTATCGATCTG
                      ____________________________________________________________
consensus GCCGTGCCCGCACCCGTGACTCCAGAACTCAAATCTCACCGACGGGTAACTATCGATCTG
 
. : . : . : . : . : . :
JMFS016G01+ ATATATACAAGCTAGGGTTTTTCTTTGTGAAAAGCAAATCAGAAGCTCCCAAATCGACTA
JMFF009P22+ ATATATACAAGCTAGGGTTTTTCTTTGTGAAAAGCAAATCAGAAGCTCCCAAATCGACTA
                      ____________________________________________________________
consensus ATATATACAAGCTAGGGTTTTTCTTTGTGAAAAGCAAATCAGAAGCTCCCAAATCGACTA
 
. : . : . : . : . : . :
JMFS016G01+ ATCGGTTAGGGTTGAGAGTTTCGTTTACGCAGCAA
JMFF009P22+ ATCGGTTAGGGTTGAGAGTTTCGTTTACGCAGCAATCACCTATACTGTGTTGAAGGACTT
                      ____________________________________________________________
consensus ATCGGTTAGGGTTGAGAGTTTCGTTTACGCAGCAATCACCTATACTGTGTTGAAGGACTT