Previous Contig 000523:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005J14Sequence442000523 (22)gb:AJ630658_18127713e-28Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene738000523 (22)gb:AY085407_15704761e-30Arabidopsis thaliana clone 15027 mRNA, complete sequence.
JMFF009N13Sequence275000523 (22)324000523 (22)
JMFF015M01Sequence589000523 (22)gb:AJ630658_18127711e-30Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene653000523 (22)gb:AY085407_15704768e-31Arabidopsis thaliana clone 15027 mRNA, complete sequence.
JMFF034M12Sequence401000523 (22)gb:AJ630658_18127712e-19Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene
JMFF035F04Sequence351000523 (22)gb:AJ630658_18127717e-13Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene274000523 (22)
JMFF045I14Sequence643000523 (22)gb:AY085407_15704768e-31Arabidopsis thaliana clone 15027 mRNA, complete sequence.619000523 (22)gb:AY085407_15704763e-30Arabidopsis thaliana clone 15027 mRNA, complete sequence.
JMFF046I04Sequence539000523 (22)gb:AJ630658_18127711e-30Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene489000523 (22)gb:AY085407_15704762e-14Arabidopsis thaliana clone 15027 mRNA, complete sequence.
JMFN003F20Sequence612000523 (22)gb:AY085407_15704767e-31Arabidopsis thaliana clone 15027 mRNA, complete sequence.
JMFN006P23Sequence589000523 (22)gb:AY085407_15704764e-31Arabidopsis thaliana clone 15027 mRNA, complete sequence.
JMFN010J14Sequence629000523 (22)gb:AY085407_15704767e-31Arabidopsis thaliana clone 15027 mRNA, complete sequence.
JMFN013F03Sequence408000523 (22)gb:AY085407_15704763e-07Arabidopsis thaliana clone 15027 mRNA, complete sequence.
JMFN014N07Sequence449000523 (22)gb:AJ630658_18127716e-31Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene
JMFN016F03Sequence499000523 (22)gb:AJ630658_18127715e-31Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene
JMFN035A13Sequence571000523 (22)gb:AJ630658_18127712e-22Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene
JMFN038L05Sequence449000523 (22)gb:AJ630658_18127712e-28Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene
JMFN041E22Sequence620000523 (22)gb:AY085407_15704767e-31Arabidopsis thaliana clone 15027 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046I04- AAATTAAAGGCTCTTGAT
JMFN013F03+ AAATTAAAGGCTCTTGAT
JMFN035A13+ TCGAGTTTTTTTTTTTTTTTTTGNAGAAAACATAAAATAAATTAAAGGCTCTTGAT
rJMFF045I14- AGAAAACATAAAATAAATTAAAGGCTCTTGAT
                      ____________________________________________________________
consensus TCGAGTTTTTTTTTTTTTTTTTGNAGAAAACATAAAATAAATTAAAGGCTCTTGAT
 
. : . : . : . : . : . :
rJMFF046I04- AATTTTCCAACGTACAAATTAAAACAGCATGAAGAGTGGAAATGGAGATTAATTAAAGAA
JMFN013F03+ AATTTTCCAACGTACAAATTAAAACAGCATGAAGAGTGGAAATGGAGATTAATTAAAGAA
rJMFF009N13- CAGCATGAAGAGTGGAAATGGAGATTAATTAAAGAA
rJMFF035F04- AGCATGAAGAGTGGAAATGGAGATTAATTAAAGAA
JMFN035A13+ AATTTTCCAACGTACAAATTAAAACAGCATGAAGAGTGGAAATGGAGATTAATTAAAGAA
rJMFF045I14- AATTTTCCAACGTACAAATTAAAACAGCATGAAGAGTGGAAATGGAGATTAATTAAAGAA
rJMFF015M01- TAAAGAA
rJMFF005J14- ACGTACAAATTAAAACAGCATGAAGAGTGGAAATGGAGATTAATTAAAGAA
                      ____________________________________________________________
consensus AATTTTCCAACGTACAAATTAAAACAGCATGAAGAGTGGAAATGGAGATTAATTAAAGAA
 
. : . : . : . : . : . :
rJMFF046I04- AATTAGAACAATTAAAATACCAATAACTACGTACTGCAGACTACAACACATCACCCTGCA
JMFN013F03+ AATTAGAACAATTAAAATACCAATAACTACGTACTGCAGGCTACAACACATCACCCTGCA
rJMFF009N13- AATTAGAACAATTAAAATACCAATAACTACGTACTGCAGGCTACAACACATCACCCTGCA
rJMFF035F04- NATTANAACAATTAAAATACCAATAACTACGTACTGCAGGCTACAACACATCACCCTGCA
JMFN035A13+ AATTAGAACAATTAAAATACCAATAACTACGTACTGCAGGCTACAACACATCACCCTGCA
rJMFF045I14- AATTAGAACAATTAAAATACCAATAACTACGTACTGCAGGCTACAACACATCACCCTGCA
rJMFF015M01- AATTAGAACAATTAAAATACCAATAACTACGTACTGCAGGCTACAACACATCACCCTGCA
JMFN010J14+ CAATAACTACGTACTGCAGGCTACAACACATCACCCTGCA
JMFN041E22+ TACAACACATCA-CCTGCA
rJMFF005J14- AATTAGAACAATTAAAATACCAATAACTACGTACTGCAGGCTACAACACATCACCCTGCA
                      ____________________________________________________________
consensus AATTAGAACAATTAAAATACCAATAACTACGTACTGCAGGCTACAACACATCACCCTGCA
 
. : . : . : . : . : . :
rJMFF046I04- ATTCAAACCACACTTGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
JMFN013F03+ ATTCAAACCACACTTGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
rJMFF009N13- ATTCAAACCACACTTGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
rJMFF035F04- ATTCAAACCACACTTGGAAAAGCCCANAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
JMFN035A13+ ATTCAAACCACACTTGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
rJMFF045I14- ATTCAAACCACACTTGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
rJMFF015M01- ATTCAAACCACACTTGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
JMFN010J14+ ATTCAAACCACACTTGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
JMFN003F20+ ACCACACTT-GAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
JMFN041E22+ A-TCAAACCACAC-TGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
rJMFF005J14- ATTCAAACCACACTTGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
JMFN006P23+ CGACGGCAGCGGTCAACAAGGGC
JMFF045I14+ GGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
                      ____________________________________________________________
consensus ATTCAAACCACACTTGGAAAAGCCCAGAAAACGACGGCGACGGCAGCGGCCAACAAGGGC
 
. : . : . : . : . : . :
rJMFF046I04- ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
JMFN013F03+ ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
rJMFF009N13- ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
rJMFF035F04- ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-ANAGT-CACCGCCAGCGGTGG
JMFN035A13+ ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
rJMFF045I14- ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
rJMFF015M01- ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
JMFN010J14+ ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
JMFN003F20+ ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
JMFN041E22+ ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
rJMFF005J14- ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
JMFN006P23+ ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
JMFN016F03+ GAGCTGCGGGGCGTGCTTGAACGACCCACCAAGAGT-CACCGCCAGCGGTGG
JMFF045I14+ ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
JMFN014N07+ G
JMFF015M01+ GCTGCGGGGCGTGCTTGAACGACCCACC-AGAGTCCACCGCCAGCGGTGG
                      ____________________________________________________________
consensus ACTCCGGCGAGCTGCGGGGCGTGCTTGAACGACCCACC-AGAGT-CACCGCCAGCGGTGG
 
. : . : . : . : . : . :
rJMFF046I04- CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFN013F03+ CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCCTAGTGGCGTGACTAG
rJMFF009N13- CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
rJMFF035F04- CCGGCTGTGACGTTGAGCCGCCGGGAGATGCNCCGGGGGTTTTCGAANTGGCGTGACTA
JMFN035A13+ CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
rJMFF045I14- CCGGCTGACACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCAAAGTGGCGTGACTAG
rJMFF015M01- CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFN010J14+ CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFN003F20+ CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFN041E22+ CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
rJMFF005J14- CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFN006P23+ CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFN016F03+ CCGGCTGTGAAGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFF045I14+ CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFF046I04+ CGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFN014N07+ CCGGCTGTGACGTTGAGCCGCCGGAAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
JMFF015M01+ CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
                      ____________________________________________________________
consensus CCGGCTGTGACGTTGAGCCGCCGGGAGATGCGCCGGGGGTTTTCGAAGTGGCGTGACTAG
 
. : . : . : . : . : . :
rJMFF046I04- TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFN013F03+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
rJMFF009N13- TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGT
JMFN035A13+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
rJMFF045I14- TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
rJMFF015M01- TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFN010J14+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFN003F20+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFN041E22+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
rJMFF005J14- TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFN006P23+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFN016F03+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFF045I14+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFF046I04+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFF005J14+ TAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFN014N07+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFN038L05+ TTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
JMFF015M01+ TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
                      ____________________________________________________________
consensus TTGTAGCGTTAGTGAAGATGGCGGCGTCCGGAGAGCCCGCCGGAAGGTTCAACAGTTTAG
 
. : . : . : . : . : . :
rJMFF046I04- GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFN013F03+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTG
JMFN035A13+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
rJMFF045I14- GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
rJMFF015M01- GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFN010J14+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFN003F20+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFN041E22+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
rJMFF005J14- GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFN006P23+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFN016F03+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFF045I14+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFF046I04+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFF005J14+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFN014N07+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFN038L05+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFF034M12+ ATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
JMFF015M01+ GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
                      ____________________________________________________________
consensus GGCAGTTGGTGGTGCTGGCATTGGCGAGCTTGCACTCGGACGGGAGCTTAAGCAACCGAT
 
. : . : . : . : . : . :
rJMFF046I04- CCTCTTTAATGGCCAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGT
JMFN035A13+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
rJMFF045I14- CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
rJMFF015M01- CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFN010J14+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFN003F20+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFN041E22+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
rJMFF005J14- CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFN006P23+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFN016F03+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFF045I14+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFF046I04+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFF005J14+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFN014N07+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFN038L05+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFF034M12+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFF035F04+ CCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
JMFF015M01+ CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
                      ____________________________________________________________
consensus CCTCTTTAATGCCAAGACTCGTGACGGAGCTATCCCCTTTATGAACCTGCTGTATAACGT
 
. : . : . : . : . : . :
JMFN035A13+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGA
rJMFF045I14- AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
rJMFF015M01- AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFN010J14+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFN003F20+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFN041E22+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
rJMFF005J14- AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFN006P23+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFN016F03+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFF045I14+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFF046I04+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFF005J14+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFN014N07+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFN038L05+ AGCAGAGGCACGCCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFF034M12+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFF035F04+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFF015M01+ AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
JMFF009N13+ CTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
                      ____________________________________________________________
consensus AGCAGAGGCACACCGGATCCGTCTCCTTAATGCTCGACACCGAGTCGCAGCACTTCTTGC
 
. : . : . : . : . : . :
rJMFF045I14- TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATC
rJMFF015M01- TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFN010J14+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFN003F20+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFN041E22+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
rJMFF005J14- TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFN006P23+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFN016F03+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFF045I14+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFF046I04+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFF005J14+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFN014N07+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFN038L05+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFF034M12+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFF035F04+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFF015M01+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
JMFF009N13+ TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCNTCNCTTTCGGCGACTCTT
                      ____________________________________________________________
consensus TCGGCGCGTCCGCCGTCCCGATCGCGTACGACAAGCAATCCATCACTTTCGGCGACTCTT
 
. : . : . : . : . : . :
rJMFF015M01- TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFN010J14+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFN003F20+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFN041E22+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
rJMFF005J14- TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFN006P23+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFN016F03+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFF045I14+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFF046I04+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGGCGCAAACAACCA
JMFF005J14+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFN014N07+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFN038L05+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFF034M12+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFF035F04+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFF015M01+ TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
JMFF009N13+ TCCCGCACTTGTCCTTCAAGTCATCNTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
                      ____________________________________________________________
consensus TCCCGCACTTGTCCTTCAAGTCATCCTTCGCCGCCGCCCCGCCGCCGCCGCAAACAACCA
 
. : . : . : . : . : . :
rJMFF015M01- ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCC
JMFN010J14+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAAC
JMFN003F20+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFN041E22+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
rJMFF005J14- ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFN006P23+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFN016F03+ ACAACACCAAACCCAACACTT
JMFF045I14+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFF046I04+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFF005J14+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFN014N07+ ACAACACCAAACCCAACACTT
JMFN038L05+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFF034M12+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFF035F04+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFF015M01+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
JMFF009N13+ ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
                      ____________________________________________________________
consensus ACAACACCAAACCCAACACTTTAACGTCCCTTAACATCATTTTTCTCCAACTTCTTCTCA
 
. : . : . : . : . : . :
JMFN003F20+ ATAATTCTACTAGCTAACCTT
JMFN041E22+ A
rJMFF005J14- ATAATTCTACTAGCTAACCTTA
JMFN006P23+ ATAATTCTACTAGCTAACCTTAGAACAA
JMFF045I14+ ATAATTCTACTAGCTAACCTTAGAACAACACAGCTTAAACAATTCGAGAAGAACTAAAGT
JMFF046I04+ ATAATTCTACTAGCTAACCTTAGAACAACACAGCTTAAACAATTCGAGAAGAACTAAAGT
JMFF005J14+ ATAATTCTACTAGCTAACCTTAGAACAACAC
JMFN038L05+ ATAATTCTACTAGCTAACCTTAGAACAAC
JMFF034M12+ ATAATTCTACTAGCTAACCTTAGAACAACACAGCTTAAACAATTCGAGAAGAACTAAAGT
JMFF035F04+ ATAATTCTACTAGCTAACCTTAGAACAACACAGCTTAAACAATTCGAGAAGAACTAAAGT
JMFF015M01+ ATAATTCTACTAGCTAACCTTAGAACAACACAGCTTAAACAATTCGAGAAGAACTAAAGT
JMFF009N13+ ATAATTCTACTAGCTAACCTTAGAACAACACAGCTTAAACAATTCGAGAAGAANTAAAGT
                      ____________________________________________________________
consensus ATAATTCTACTAGCTAACCTTAGAACAACACAGCTTAAACAATTCGAGAAGAACTAAAGT