Previous Contig 000514:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009L05Sequence610000514 (4)741008614 (3)gb:AK176239_18182275e-16Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-12-N11.
JMFS047G08Sequence617000514 (4)
JMFS114D10Sequence546000514 (4)
JMSF022M18Sequence626000514 (4)782012272 (2)gb:AK176239_18182271e-78Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-12-N11.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS114D10+ TGCGTTCTCTTCTAGATCTATTATCTTCATCCATTATCTAGTATCTGCTCAGAAATGAAT
                      ____________________________________________________________
consensus TGCGTTCTCTTCTAGATCTATTATCTTCATCCATTATCTAGTATCTGCTCAGAAATGAAT
 
. : . : . : . : . : . :
JMFS114D10+ ATCAACTCTGTCTGTGGTTGCAAGTCGGTCTTCAACAGTGGTAAATGACAGTGAGGCTAC
                      ____________________________________________________________
consensus ATCAACTCTGTCTGTGGTTGCAAGTCGGTCTTCAACAGTGGTAAATGACAGTGAGGCTAC
 
. : . : . : . : . : . :
JMFS114D10+ AGCGTTCAGACTTCAGGGCTCAGGCTACGGTGGTCGGTGGCGAGGAGAGTAAGTGAGTGG
JMFS047G08+ AGCGTTCAGACTTCAGGGCTCAGGCTACGGTGGTCGGTGGCGAGGAGAGTAAGTGAGTGG
JMSF022M18+ TACGGTGGTCGGTGGCGAGGAGAGTAAGTGAGTGG
JMFF009L05+ AAGTGAGTGG
                      ____________________________________________________________
consensus AGCGTTCAGACTTCAGGGCTCAGGCTACGGTGGTCGGTGGCGAGGAGAGTAAGTGAGTGG
 
. : . : . : . : . : . :
JMFS114D10+ CTGCGTGAAGTGCCGGCTGCGGGCTAGGTATGGAGGTATAGACTATGCCAGTAAGGTGTT
JMFS047G08+ CTGCGTGAAGTGCCGGCTGCGGGCTAGGTATGGAGGTATAGACTATGCCAGTAAGGTGTT
JMSF022M18+ CTGCGTGAAGTGCCGGCTGCGGGCTAGGTATGGAGGTATAGACTATGCCAGTAAGGTGTT
JMFF009L05+ CTGCGTGAAGTGCCGGCTGCGGGCTAGGTATGGAGGTATAGACTATGCCAGTAAGGTGTT
                      ____________________________________________________________
consensus CTGCGTGAAGTGCCGGCTGCGGGCTAGGTATGGAGGTATAGACTATGCCAGTAAGGTGTT
 
. : . : . : . : . : . :
JMFS114D10+ GGAGTATGCGATTAGGATTCTAATTTCTATATATTAACCTGTGAAACTCTATTGCATTCT
JMFS047G08+ GGAGTATGCGATTAGGATTCTAATTTCTATATATTAACCTGTGAAACTCTATTGCATTCT
JMSF022M18+ GGAGTATGCGATTAGGATTCTAATTTCTATATATTAACCTGTGAAACTCTATTGCATTCT
JMFF009L05+ GGAGTATGCGATTAGGATTCTAATTTCTATATATTAACCTGTGAAACTCTATTGCATTCT
                      ____________________________________________________________
consensus GGAGTATGCGATTAGGATTCTAATTTCTATATATTAACCTGTGAAACTCTATTGCATTCT
 
. : . : . : . : . : . :
JMFS114D10+ TCAATCTATGACTTAAAATATTATCTATCTACACCACTCCTTAAAATAATTAAGCAGCAC
JMFS047G08+ TCAATCTATGACTTAAAATATTATCTATCTACACCACTCCTTAAAATAATTAAGCAGCAC
JMSF022M18+ TCAATCTATGACTTAAAATATTATCTATCTACACCACTCCTTAAAATAATTAAGCAGCAC
JMFF009L05+ TCAATCTATGACTTAAAATATTATCTATCTACACCACTCCTTAAAATAATTAAGCAGCAC
                      ____________________________________________________________
consensus TCAATCTATGACTTAAAATATTATCTATCTACACCACTCCTTAAAATAATTAAGCAGCAC
 
. : . : . : . : . : . :
JMFS114D10+ AGTAGTGACAGTACGCAGCAAGCCAGCACAGTACGCAACACACCACCAAAATATATTACA
JMFS047G08+ AGTAGTGACAGTACGCAGCAAGCCAGCACAGTACGCAACACACCACCAAAATATATTACA
JMSF022M18+ AGTAGTGACAGTACGCAGCAAGCCAGCACAGTACGCAACACACCACCAAAATATATTACA
JMFF009L05+ AGTAGTGACAGTACGCAGCAAGCCAGCACAGTACGCAACACACCACCAAAATATATTACA
                      ____________________________________________________________
consensus AGTAGTGACAGTACGCAGCAAGCCAGCACAGTACGCAACACACCACCAAAATATATTACA
 
. : . : . : . : . : . :
JMFS114D10+ AATAATTGTGGGAATGAAGAACTAATATATATATTAAAATAAATATATTAAGCAGCACAG
JMFS047G08+ AATAATTGTGGGAATGAAGAACTAATATATATATTAAAATAAATATATTAAGCAGCACAG
JMSF022M18+ AATAATTGTGGGAATGAAGAACTAATATATATATTAAAATAAATATATTAAGCAGCACAG
JMFF009L05+ AATAATTGTGGGAATGAAGAACTAATATATATATTAAAATAAATATATTAAGCAGCACAG
                      ____________________________________________________________
consensus AATAATTGTGGGAATGAAGAACTAATATATATATTAAAATAAATATATTAAGCAGCACAG
 
. : . : . : . : . : . :
JMFS114D10+ CACTGTAATATTAAACAGAGGACTGAGGAGTAGTCGACCTACGCAACAAATTTGTGAGAG
JMFS047G08+ CACTGTAATATTAAACAGAGGACTGAGGAGTAGTCGACCTACGCAACAAATTTGTGAGAG
JMSF022M18+ CACTGTAATATTAAACAGAGGACTGAGGAGTAGTCGACCTACGCAACAAATTTGTGAGAG
JMFF009L05+ CACTGTAATATTAAACAGAGGACTGAGGAGTAGTCGACCTACGCAACAAATTTGTGAGAG
                      ____________________________________________________________
consensus CACTGTAATATTAAACAGAGGACTGAGGAGTAGTCGACCTACGCAACAAATTTGTGAGAG
 
. : . : . : . : . : . :
JMFS114D10+ TGAAGA
JMFS047G08+ TGAAGACGGAGGACGGAGGAGTAGTCGACCTACGCAGGTTGCAGAGTGGGCAGCGAGGCG
JMSF022M18+ TGAAGACGGAGGACGGAGGAGTAGTCGACCTACGCAGGTTGCAGAGTGGGCAGCGAGGCG
JMFF009L05+ TGAAGACGGAGGACGGAGGAGTAGTCGACCTACGCAGGTTGCAGAGTGGGCAGCGAGGCG
                      ____________________________________________________________
consensus TGAAGACGGAGGACGGAGGAGTAGTCGACCTACGCAGGTTGCAGAGTGGGCAGCGAGGCG
 
. : . : . : . : . : . :
JMFS047G08+ CCGAGGCCAGACTGCGGAGGGCGTGCGGCAACTCGGTGAGTGAGGCTTGGCGTCGTTGAC
JMSF022M18+ CCGAGGCCAGACTGCGGAGGGCGTGCGGCAACTCGGTGAGTGAGGCTTGGCGTCGTTGAC
JMFF009L05+ CCGAGGCCAGACTGCGGAGGGCGTGCGGCAACTCGGTGAGTGAGGCTTGGCGTCGTTGAC
                      ____________________________________________________________
consensus CCGAGGCCAGACTGCGGAGGGCGTGCGGCAACTCGGTGAGTGAGGCTTGGCGTCGTTGAC
 
. : . : . : . : . : . :
JMFS047G08+ TGTGGGGCGTGGGCTGTCGGCTACGTCGGGGTGGGAGAAGAGAAACGAGGAAGTGAGAAA
JMSF022M18+ TGTGGGGCGTGGGCTGTCGGCTACGTCGGGGTGGGAGAAGAGAAACGAGGAAGTGAGAAA
JMFF009L05+ TGTGGGGCGTGGGCTGTCGGCTACGTCGGGGTGGGAGAAGAGAAACGAGGAAGTGAGAAA
                      ____________________________________________________________
consensus TGTGGGGCGTGGGCTGTCGGCTACGTCGGGGTGGGAGAAGAGAAACGAGGAAGTGAGAAA
 
. : . : . : . : . : . :
JMFS047G08+ CGGAGAGGACAGAGGAG
JMSF022M18+ CGGAGAGGACAGAGGAGTAGTCTGTGACTCTGTGTAGAAGACCTAGGGTT
JMFF009L05+ CGGAGAGGACAGAGGAGTAGTCTGTGACTCTGTGTAGAAGACCTAGGGTTAACAAGACAC
                      ____________________________________________________________
consensus CGGAGAGGACAGAGGAGTAGTCTGTGACTCTGTGTAGAAGACCTAGGGTTAACAAGACAC