Previous Contig 000513:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004K10Sequence596000513 (3)gb:AF190652_17754375e-86Phaseolus vulgaris putative integral membrane protein (sec61) mRNA, sec61-1 alle717005998 (6)pir|B96816|B968163e-87hypothetical protein F9K20.24 [imported] - Arabidopsis thaliana>gb:AE005173_8953
JMFF009K21Sequence576000513 (3)gb:AF190652_17754378e-74Phaseolus vulgaris putative integral membrane protein (sec61) mRNA, sec61-1 alle683005998 (6)pir|B96816|B968162e-82hypothetical protein F9K20.24 [imported] - Arabidopsis thaliana>gb:AE005173_8953
JMSF036K19Sequence683000513 (3)gb:AF190652_1775437e-106Phaseolus vulgaris putative integral membrane protein (sec61) mRNA, sec61-1 alle700005998 (6)pir|B96816|B968165e-83hypothetical protein F9K20.24 [imported] - Arabidopsis thaliana>gb:AE005173_8953

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036K19+ ACGGCCAGTATTAATGGTTGTGGGACTGAATGCTTTCCAGATAATATTTTCAC
                      ____________________________________________________________
consensus ACGGCCAGTATTAATGGTTGTGGGACTGAATGCTTTCCAGATAATATTTTCAC
 
. : . : . : . : . : . :
JMSF036K19+ AGATATTGGTAAGCTATAAATAGGGAAATCCCAGAACCAAGACCATATCCTTTCTGGAGG
                      ____________________________________________________________
consensus AGATATTGGTAAGCTATAAATAGGGAAATCCCAGAACCAAGACCATATCCTTTCTGGAGG
 
. : . : . : . : . : . :
JMSF036K19+ AGTTCATCTAAACAGAT-GACGATAATACCAGCAAAGCAAAGTTGAATAATGATAAGAAT
JMFF004K10+ TAAACAGATGGACGATAATACCAGCAAAGCAAAGTTGAATAATGATAAGAAT
                      ____________________________________________________________
consensus AGTTCATCTAAACAGATGGACGATAATACCAGCAAAGCAAAGTTGAATAATGATAAGAAT
 
. : . : . : . : . : . :
JMSF036K19+ AGCATTCCCAACACCCAATTGACCAACACTTCCATACATCCCTGATAGGACATAAGCAAC
JMFF004K10+ AGCATTCCCAACACCCAATTGACCAACACTTCCATACATCCCTGATAGGACATAAGCAAC
JMFF009K21+ AACACTTCCATACATCCCTGATAGGACATAAGCAAC
                      ____________________________________________________________
consensus AGCATTCCCAACACCCAATTGACCAACACTTCCATACATCCCTGATAGGACATAAGCAAC
 
. : . : . : . : . : . :
JMSF036K19+ TGCCTCCCCAATAGCAATCAGGATACCTAACAACTTTTGAGCACCATTTAATAGTGCACG
JMFF004K10+ TGCCTCCCCAATAGCAATCAGGATACCTAACAACTTTTGAGCACCATTTAATAGTGCACG
JMFF009K21+ TGCCTCCCCAATAGCAATCAGGATACCTAACAACTTTTGAGCACCATTTAATAGTGCACG
                      ____________________________________________________________
consensus TGCCTCCCCAATAGCAATCAGGATACCTAACAACTTTTGAGCACCATTTAATAGTGCACG
 
. : . : . : . : . : . :
JMSF036K19+ GTCCTCTCTGACATTGTTGTCCACTTCAATGATTTTTGAACCAGCCAATAGTTGCATCAC
JMFF004K10+ GTCCTCTCTGACATTGTTGTCCACTTCAATGATTTTTGAACCAGCCAATAGTTGCATCAC
JMFF009K21+ GTCCTCTCTGACATTGTTGTCCACTTCAATGATTTTTGAACCAGCCAATAGTTGCATCAC
                      ____________________________________________________________
consensus GTCCTCTCTGACATTGTTGTCCACTTCAATGATTTTTGAACCAGCCAATAGTTGCATCAC
 
. : . : . : . : . : . :
JMSF036K19+ CAACCCAGAAGTCACAATTGGTGTGATTCCCAACTCCATGACCGTACCACGGTTTGAGGC
JMFF004K10+ CAACCCAGAAGTCACAATTGGTGTGATTCCCAACTCCATGACCGTACCACGGTTTGAGGC
JMFF009K21+ CAACCCAGAAGTCACAATTGGTGTGATTCCCAACTCCATGACCGTACCACGGTTTGAGGC
                      ____________________________________________________________
consensus CAACCCAGAAGTCACAATTGGTGTGATTCCCAACTCCATGACCGTACCACGGTTTGAGGC
 
. : . : . : . : . : . :
JMSF036K19+ AAGAATAACACGCATCCAATAAAATGGATCAGCACCAGTTGTAGAGTGTATGCCATAAAG
JMFF004K10+ AAGAATAACACGCATCCAATAAAATGGATCAGCACCAGTTGTAGAGTGTATGCCATAAAG
JMFF009K21+ AAGAATAACACGCATCCAATAAAATGGATCAGCACCAGTTGTAGAGTGTATGCCATAAAG
                      ____________________________________________________________
consensus AAGAATAACACGCATCCAATAAAATGGATCAGCACCAGTTGTAGAGTGTATGCCATAAAG
 
. : . : . : . : . : . :
JMSF036K19+ AGGAAGCTGACTGCAGACCAGGAAGATGAAAAGAGAGATCACAGTGTATATGACCTTCTC
JMFF004K10+ AGGAAGCTGACTGCAGACCAGGAAGATGAAAAGAGAGATCACAGTGTATATGACCTTCTC
JMFF009K21+ AGGAAGCTGACTGCAGACCAGGAAGATGAAAAGAGAGATCACAGTGTATATGACCTTCTC
                      ____________________________________________________________
consensus AGGAAGCTGACTGCAGACCAGGAAGATGAAAAGAGAGATCACAGTGTATATGACCTTCTC
 
. : . : . : . : . : . :
JMSF036K19+ TCTGAAGGGAATCTTTCTGTCAGCACTCTGAACTTCTGGCAGAAATGAGAGAAATGGTTT
JMFF004K10+ TCTGAAGGGAATCTTTCTGTCAGCACTCTGAACTTCTGGCAGAAATGAGAGAAATGGTTT
JMFF009K21+ TCTGAAGGGAATCTTTCTGTCAGCACTCTGAACTTCTGGCAGAAATGAGAGAAATGGTTT
                      ____________________________________________________________
consensus TCTGAAGGGAATCTTTCTGTCAGCACTCTGAACTTCTGGCAGAAATGAGAGAAATGGTTT
 
. : . : . : . : . : . :
JMSF036K19+ GACAAGATGCAGCACTCTGAACCCTCCACCCATTTTCACAAAAGGTAGAAACGCAGATCC
JMFF004K10+ GACAAGATGCAGCACTCTGAACCCTCCACCCATTTTCACAAAAGGTAGAAACGCAGATCC
JMFF009K21+ GACAAGATGCAGCACTCTGAACCCTCCACCCATTTTCACAAAAGGTAGAAACGCAGATCC
                      ____________________________________________________________
consensus GACAAGATGCAGCACTCTGAACCCTCCACCCATTTTCACAAAAGGTAGAAACGCAGATCC
 
. : . : . : . : . : . :
JMSF036K19+ GCAGGAGGATGGCAAGAAAGGCTTTCACCT
JMFF004K10+ GCAGGAGGATGGCAAGAAAGGCTTTCACCTAGTCTCTCTCTCTCTCTCTCTCTC
JMFF009K21+ GCAGGAGGATGGCAAGAAAGGCTTTCACCTAGTCTCTCTCTCTCTCTCTCTCTCTGCTAT
                      ____________________________________________________________
consensus GCAGGAGGATGGCAAGAAAGGCTTTCACCTAGTCTCTCTCTCTCTCTCTCTCTCTGCTAT
 
. : . : . : . : . : . :
JMFF009K21+ TTCTAGGGTTTTGGTGTGAGAGAGAAAGGTGAAACAATTTGATTGTGAGTACCGAGCCGT
                      ____________________________________________________________
consensus TTCTAGGGTTTTGGTGTGAGAGAGAAAGGTGAAACAATTTGATTGTGAGTACCGAGCCGT