Previous Contig 000503:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008D13Sequence498000503 (20)gb:AP003842_18340831e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16678000503 (20)gb:AP003842_18340839e-84Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMFF009J08Sequence576000503 (20)gb:AF262934_17816436e-73Avicennia marina ubiquitin conjugating protein (UBC) mRNA, complete cds.679000503 (20)gb:AP003842_18340833e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMFF013O10Sequence553000503 (20)gb:AP003842_18340837e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16782000503 (20)gb:AP003842_18340831e-84Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMFF015L06Sequence562000503 (20)gb:AP003842_18340835e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16721000503 (20)gb:AP003842_18340839e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMFF016G10Sequence584000503 (20)gb:AP003842_18340836e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16694000503 (20)gb:AP003842_18340838e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMFF051B03Sequence601000503 (20)gb:AP003842_18340831e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMFN006D01Sequence619000503 (20)gb:AP003842_18340836e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMFN012N24Sequence608000503 (20)gb:AP003842_18340836e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMSF012I07Sequence246000503 (20)gb:AF262934_17816433e-28Avicennia marina ubiquitin conjugating protein (UBC) mRNA, complete cds.718000503 (20)gb:AP003842_18340839e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMSF013I07Sequence227000503 (20)gb:AF262934_17816437e-26Avicennia marina ubiquitin conjugating protein (UBC) mRNA, complete cds.708000503 (20)gb:AP003842_18340839e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMSF026G18Sequence602000061 (44)gb:AY220077_15904232e-61Nicotiana tabacum putative photosystem I subunit III precursor, mRNA, complete c702000503 (20)gb:AP003842_18340838e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16
JMSF050M07Sequence659000503 (20)gb:AP003842_18340831e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16712000503 (20)gb:AP003842_18340831e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008D13- TTCTCATGTT
rJMFF009J08- TCTCATGTT
rJMFF013O10- TCTCATGTT
rJMFF016G10- TCTCATGTT
rJMFF015L06- CATGTT
                      ____________________________________________________________
consensus TTCTCATGTT
 
. : . : . : . : . : . :
rJMFF008D13- CTTGATATAGAAAATTTTACTTTACAGAAGCCTGGCAACACAATGCAGCAAATCTTACCT
rJMFF009J08- CTTGATATAGAAAATTTTACTTTACAGAAGCCTGGCAACACAATGCAGCAAATCTTACCT
rJMFF013O10- CTTGATATAGAAAATTTTACTTTACAGAAGCCTGGCAACACAATGCAGCAAATCTTACCT
rJMFF016G10- CTTGATATAGAAAATTTTACTTTACAGAAGCCTGGCAACACAATGCAGCAAATCTTACCT
rJMFF015L06- CTTGATATAGAAAATTTTACTTTACAGAAGCCTGGCAACACAATGCAGCAAATCTTACCT
rJMSF013I07- TTTTACTTTACAGAAGCCTGGCAACACAATGCAGCAAATCTTACCT
rJMSF026G18- TTTACTTTACAGAAGCCTGGCAACACAATGCAGCAAATCTTACCT
rJMSF050M07- TTTTACTTTACAGAAGCCTGGCAACATAATGCAGCAAATCTTACCT
rJMSF012I07- AAATTTTACTTTACAGAAGCCTGGCAACACAATGCAGCAAATCTTACCT
                      ____________________________________________________________
consensus CTTGATATAGAAAATTTTACTTTACAGAAGCCTGGCAACACAATGCAGCAAATCTTACCT
 
. : . : . : . : . : . :
rJMFF008D13- AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
rJMFF009J08- AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
rJMFF013O10- AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
rJMFF016G10- AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
JMFF016G10+ AATTAAGAAAGGCAGGAAG
rJMFF015L06- AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
rJMSF013I07- AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
rJMSF026G18- AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
rJMSF050M07- AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
rJMSF012I07- AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
JMSF050M07+ TGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
                      ____________________________________________________________
consensus AGTATCTTGACTGCTATAATAAGGTAAAAACAAATGTGTTCAATTAAGAAAGGCAGGAAG
 
. : . : . : . : . : . :
rJMFF008D13- AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
rJMFF009J08- AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
rJMFF013O10- AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
JMFN006D01+ AAGCCCTTGAGATAGATGCCA
JMFN012N24+ ATGCCA
rJMFF016G10- AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
JMFF016G10+ AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
rJMFF015L06- AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
rJMSF013I07- AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
rJMSF026G18- AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
rJMSF050M07- AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
JMFF051B03+ TTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
JMFF015L06+ TGAGATAGATGCCA
rJMSF012I07- AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
JMSF050M07+ AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
                      ____________________________________________________________
consensus AAGATTTTCCAATTCAGAAAATGTTGCATAAAGAGCTCTAAGCCCTTGAGATAGATGCCA
 
. : . : . : . : . : . :
rJMFF008D13- GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
rJMFF009J08- GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
rJMFF013O10- GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
JMFN006D01+ GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
JMFN012N24+ GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
JMFF013O10+ CTCGTA
rJMFF016G10- GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
JMFF016G10+ GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
rJMFF015L06- GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
rJMSF013I07- GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
rJMSF026G18- GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
rJMSF050M07- GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
JMFF051B03+ GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGC-TTGTTCAACAATCTCTCGTA
JMFF015L06+ GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
JMFF008D13+ ATCTCTCGTA
rJMSF012I07- GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
JMSF050M07+ GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
                      ____________________________________________________________
consensus GATGGCTACATTTCAGTGGGTATCAGTCTGCAGTCCAGCTTTGTTCAACAATCTCTCGTA
 
. : . : . : . : . : . :
rJMFF008D13- CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
rJMFF009J08- CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
rJMFF013O10- CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
JMFN006D01+ CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
JMFN012N24+ CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
JMFF013O10+ CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
rJMFF016G10- CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
JMFF016G10+ CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
rJMFF015L06- CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
rJMSF013I07- CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
rJMSF026G18- CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
rJMSF050M07- CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
JMFF051B03+ CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
JMFF015L06+ CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
JMFF008D13+ CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
rJMSF012I07- CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
JMSF050M07+ CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
JMFF009J08+ TTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
                      ____________________________________________________________
consensus CTTTGCGGTTGTATTCACGCTTGTTCTCACTGAATAAACGAGCAGCTTCAGAATTTGCAG
 
. : . : . : . : . : . :
rJMFF008D13- GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
rJMFF009J08- GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
rJMFF013O10- GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
JMFN006D01+ GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
JMFN012N24+ GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
JMFF013O10+ GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
rJMFF016G10- GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
JMFF016G10+ GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
rJMFF015L06- GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
rJMSF013I07- GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
rJMSF026G18- GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
rJMSF050M07- GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
JMFF051B03+ GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
JMFF015L06+ GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
JMFF008D13+ GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
rJMSF012I07- GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
JMSF050M07+ GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
JMFF009J08+ GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
                      ____________________________________________________________
consensus GAGAATTTGGATTTGGATCACATAACAGCGACTGTATAGATGTGAGTATAGCTGCAACAT
 
. : . : . : . : . : . :
rJMFF008D13- CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
rJMFF009J08- CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
rJMFF013O10- CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
JMFN006D01+ CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
JMFN012N24+ CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
JMFF013O10+ CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
rJMFF016G10- CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
JMFF016G10+ CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
rJMFF015L06- CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
rJMSF013I07- CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
rJMSF026G18- CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
rJMSF050M07- CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
JMFF051B03+ CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
JMFF015L06+ CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
JMFF008D13+ CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
rJMSF012I07- CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
JMSF050M07+ CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
JMFF009J08+ CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
                      ____________________________________________________________
consensus CATATATAGGACTCCACTGATTCTGAAGAATGTCCAAGCATATGCTTCCATCAGCATAGA
 
. : . : . : . : . : . :
rJMFF008D13- TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
rJMFF009J08- TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
rJMFF013O10- TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
JMFN006D01+ TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
JMFN012N24+ TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
JMFF013O10+ TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
rJMFF016G10- TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
JMFF016G10+ TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
rJMFF015L06- TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
rJMSF013I07- TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
rJMSF026G18- TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
rJMSF050M07- TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGG---GTCTT
JMFF051B03+ TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
JMFF015L06+ TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
JMFF008D13+ TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
rJMSF012I07- TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
JMSF050M07+ TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGG---GTCTT
JMFF009J08+ TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
                      ____________________________________________________________
consensus TATTTGGATGAAACATGCGAGAAACGAACCGCACTGTTGGTGGCTTGTTTGGGTAGTCTT
 
. : . : . : . : . : . :
rJMFF008D13- CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
rJMFF009J08- CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCAGGGACCA
rJMFF013O10- CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMFN006D01+ CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMFN012N24+ CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMFF013O10+ CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
rJMFF016G10- CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMFF016G10+ CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
rJMFF015L06- CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
rJMSF013I07- CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
rJMSF026G18- CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
rJMSF050M07- CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMFF051B03+ CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMFF015L06+ CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMFF008D13+ CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
rJMSF012I07- CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMSF050M07+ CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMSF012I07+ TGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMSF013I07+ AAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
JMFF009J08+ CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
                      ____________________________________________________________
consensus CAGTGAATATAAGTGTCAACTTAAACGTCCCTCCATCCCAAGGGGTATCATCA-GGACCA
 
. : . : . : . : . : . :
rJMFF008D13- AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
rJMFF009J08- AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
rJMFF013O10- AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMFN006D01+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMFN012N24+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMFF013O10+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
rJMFF016G10- AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMFF016G10+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
rJMFF015L06- AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
rJMSF013I07- AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
rJMSF026G18- AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
rJMSF050M07- AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMFF051B03+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMFF015L06+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMFF008D13+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
rJMSF012I07- AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMSF050M07+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMSF012I07+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMSF013I07+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
JMFF009J08+ AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
                      ____________________________________________________________
consensus AATATAACAGCATTCCAAAGCATAATATTGTTATCTTGAGGTGCACCACTTATTCCCGCA
 
. : . : . : . : . : . :
rJMFF008D13- GGANGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
rJMFF009J08- GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
rJMFF013O10- GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMFN006D01+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMFN012N24+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMFF013O10+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
rJMFF016G10- GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMFF016G10+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
rJMFF015L06- GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
rJMSF013I07- GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
rJMSF026G18- GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
rJMSF050M07- GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMFF051B03+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMFF015L06+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMFF008D13+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
rJMSF012I07- GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMSF050M07+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMSF012I07+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMSF013I07+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
JMFF009J08+ GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
                      ____________________________________________________________
consensus GGAGGGTCCTGTTGCAACCTCTTGAAATCCCTCATAAGCCTCTTCCTAGCTGGAGTAGAC
 
. : . : . : . : . : . :
rJMFF008D13- ATTGTAACC
rJMFF009J08- ATTGTAACCA
rJMFF013O10- ATTGTAACCAC
JMFN006D01+ ATTGTAACCAC
JMFN012N24+ ATTGTAACCAC
JMFF013O10+ ATTGTAACCAC
rJMFF016G10- ATTGTAACCACCTGTGAGGAGGCAAC
JMFF016G10+ ATTGTAACCACCTGTGAGGAGGCAAC
rJMFF015L06- ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGT
rJMSF013I07- ATTGTAACCACCTGTGAGGAGGCANCAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
rJMSF026G18- ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGC
rJMSF050M07- ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
JMFF051B03+ ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
JMFF015L06+ ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
JMFF008D13+ ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
rJMSF012I07- ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
JMSF050M07+ ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
JMSF012I07+ ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
JMSF013I07+ ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
JMFF009J08+ ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
                      ____________________________________________________________
consensus ATTGTAACCACCTGTGAGGAGGCAACAATCGCGAGGCGCTCGCTAGGGTTTCTGGTGCGT
 
. : . : . : . : . : . :
rJMSF013I07- GAG
rJMSF050M07- GAGAAGAACC
JMFF051B03+ GAGAAGAA
JMFF015L06+ GAGAAGAAC
JMFF008D13+ GAGAAGAAC
rJMSF012I07- GAGAAGAACC
JMSF050M07+ GAGAAGAACC
JMSF012I07+ GAGAAGAACC
JMSF013I07+ GAGAAGAACC
JMFF009J08+ GAGAAGAACAGAGAGAGAGAGAGATGAATGAAAAGTAGATATGGACTGAGCAGCCGTCAC
                      ____________________________________________________________
consensus GAGAAGAACCGAGAGAGAGAGAGATGAATGAAAAGTAGATATGGACTGAGCAGCCGTCAC
 
. : . : . : . : . : . :
JMFF009J08+ CAATGGCCCACCGTCCACTCGCACAATTCAGCGATGGATTCTTGCATATCTAACTTATTT
                      ____________________________________________________________
consensus CAATGGCCCACCGTCCACTCGCACAATTCAGCGATGGATTCTTGCATATCTAACTTATTT