Previous Contig 000498:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003H07Sequence548000498 (44)sp|Q40144|XTH1_LYCES2e-71Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L695000498 (44)sp|Q40144|XTH1_LYCES1e-82Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMFF005O01Sequence565000498 (44)gb:AB017025_15132773e-76Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.654000498 (44)gb:AB017025_15132775e-75Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMFF009I13Sequence494000498 (44)sp|Q40144|XTH1_LYCES3e-54Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L637000498 (44)gb:AB017025_15132775e-64Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMFF011G01Sequence542000498 (44)sp|Q40144|XTH1_LYCES2e-70Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L573000498 (44)gb:AB017025_15132778e-57Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMFF015B08Sequence575000498 (44)sp|Q40144|XTH1_LYCES4e-76Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMFF017I08Sequence585000498 (44)sp|Q40144|XTH1_LYCES2e-77Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L773000498 (44)sp|Q40144|XTH1_LYCESe-101Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMFF018G05Sequence561000498 (44)sp|Q40144|XTH1_LYCES4e-75Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L428000498 (44)gb:AB017025_15132774e-42Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMFF025P05Sequence614000498 (44)sp|Q40144|XTH1_LYCES3e-82Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L706000498 (44)sp|Q40144|XTH1_LYCES1e-83Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMFF029P02Sequence523000498 (44)sp|Q40144|XTH1_LYCES4e-68Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L793000498 (44)sp|Q40144|XTH1_LYCESe-101Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMFF040N09Sequence465000498 (44)sp|Q40144|XTH1_LYCES7e-55Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L774000498 (44)sp|Q40144|XTH1_LYCESe-102Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMFF040P21Sequence405000498 (44)sp|Q40144|XTH1_LYCES8e-43Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L643000498 (44)gb:AB017025_15132772e-68Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMFF048L05Sequence255000498 (44)sp|Q8LNZ5|XTHB_PHAAN5e-16Probable xyloglucan endotransglucosylase/hydrolase protein B precursor (EC 2.4.1230021837
JMFF049N23Sequence637000498 (44)sp|Q40144|XTH1_LYCES1e-85Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L630000498 (44)gb:AB017025_15132774e-58Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMFN005H21Sequence638000498 (44)sp|Q40144|XTH1_LYCES1e-93Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMFN006I15Sequence627000498 (44)sp|Q40144|XTH1_LYCESe-103Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMFN008J19Sequence634000498 (44)sp|P93349|XTH_TOBACe-108Probable xyloglucan endotransglucosylase/hydrolase protein precursor (EC 2.4.1.2
JMFN025D03Sequence558000498 (44)gb:AB017025_15132779e-98Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMFN038A13Sequence624000498 (44)gb:AB017025_15132773e-66Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMFS005H06Sequence559000498 (44)sp|Q40144|XTH1_LYCES6e-49Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMFS012A01Sequence472000498 (44)gb:AB017025_15132775e-38Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMFS046G03Sequence619000498 (44)gb:CAAJ4917_16447231e-73Cicer arietinum mRNA for xyloglucan endotransglucosylase/hydrolase.
JMSF002L20Sequence317000498 (44)sp|Q40144|XTH1_LYCES3e-25Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L720000498 (44)sp|Q40144|XTH1_LYCES3e-93Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMSF008P17Sequence266000498 (44)sp|Q8LNZ5|XTHB_PHAAN4e-18Probable xyloglucan endotransglucosylase/hydrolase protein B precursor (EC 2.4.1716000498 (44)sp|Q40144|XTH1_LYCES5e-93Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMSF010L05Sequence399000498 (44)sp|Q40144|XTH1_LYCES2e-41Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L738000498 (44)sp|Q40144|XTH1_LYCES5e-93Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMSF033F03Sequence646000498 (44)sp|Q40144|XTH1_LYCES4e-90Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L721000498 (44)sp|Q40144|XTH1_LYCES9e-87Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L
JMSF037D01Sequence653000498 (44)sp|Q40144|XTH1_LYCES6e-90Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L624000498 (44)gb:AB017025_15132777e-74Nicotiana tabacum mRNA for endo-xyloglucan transferase (EXGT), complete cds.
JMSF052O21Sequence655000498 (44)sp|Q40144|XTH1_LYCES2e-90Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L878000498 (44)sp|Q40144|XTH1_LYCESe-116Probable xyloglucan endotransglucosylase/hydrolase 1 precursor (EC 2.4.1.207) (L

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049N23- CCTTATGGCGGATCAACCTGGAGAGTTTTTTTTTTTTTTTTATTTTTTTTTT
                      ____________________________________________________________
consensus CCTTATGGCGGATCAACCTGGAGAGTTTTTTTTTTTTTTTTATTTTTTTTTT
 
. : . : . : . : . : . :
JMFS012A01+ AATAAAATATGATATATATCAATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
rJMFF049N23- TTTAATAAAATATGATATATATCAATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
rJMFF009I13- TTAATAAAATATGATATATATCAATAGAGAACAT-GAATTGATACNAGGCATACNAT-G
rJMFF011G01- ATTGATACAAGGCATACAAT-G
JMFN038A13+ ATAAAATATGATATATATCAATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
rJMFF040P21- TTAATAAAATATGATATATATCAATAGAGAACAT-GAATTGATACNAGGCATACNAT-G
rJMFF005O01- ATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
rJMFF003H07- ATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
rJMFF029P02- GATATATATCAATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
rJMFF040N09- GAATTGATACAAGGCATACAAT-G
rJMFF017I08- GAATTGATACAAGGCATACAAT-G
rJMSF010L05- TAGAGAACATGGAATTGATACAAGGCATACAAT-G
rJMSF033F03- TGATATATATCAATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
rJMSF037D01- GGCATACAATGG
rJMSF008P17- GGCATACAATGG
rJMSF002L20- GGCATACAATGG
rJMFF025P05- TGATATATATCAATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
rJMSF052O21- AATATGATATATATCAATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
                      ____________________________________________________________
consensus TTTAATAAAATATGATATATATCAATAGAGAACAT-GAATTGATACAAGGCATACAAT-G
 
. : . : . : . : . : . :
JMFS012A01+ ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF049N23- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF009I13- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF011G01- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF018G05- ATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
JMFN038A13+ ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF040P21- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF005O01- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF003H07- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF029P02- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF040N09- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF017I08- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMSF010L05- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMSF033F03- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMSF037D01- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMSF008P17- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMSF002L20- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
rJMFF025P05- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
JMFF005O01+ CAACA
rJMSF052O21- ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
                      ____________________________________________________________
consensus ATCACACACATATATTATGGCTGCTGCAAAGTATAGAAACAATATCTCCCCCATCCAACA
 
. : . : . : . : . : . :
JMFS012A01+ GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF049N23- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF009I13- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF011G01- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF018G05- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
JMFN038A13+ GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF040P21- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF005O01- GGACAATGGATGAATGCATTATCTGATGATGAAATAAATAACAGAACCCAGTAAATGCAG
rJMFF003H07- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF029P02- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF040N09- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF017I08- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMSF010L05- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMSF033F03- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMSF037D01- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMSF008P17- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMSF002L20- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
rJMFF025P05- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
JMFF005O01+ GGACAATGGATGAATGCATTATCTGATGATGAAATAAATAACAGAACCCAGTAAATGCAG
rJMSF052O21- GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
                      ____________________________________________________________
consensus GGACAATGGATGAATGCATTATCTGATGATGAAATAAAGAACAGAACCCAGTAAATGCAG
 
. : . : . : . : . : . :
JMFS012A01+ GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMFF049N23- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMFF009I13- GCAGCTAANAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATAATTANCACAC
rJMFF011G01- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMFF018G05- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
JMFN038A13+ GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMFF040P21- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTANCACAC
rJMFF005O01- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMFF003H07- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMFF029P02- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMFF040N09- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMFF017I08- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMSF010L05- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMSF033F03- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMSF037D01- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMSF008P17- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMSF002L20- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCGCAC
rJMFF025P05- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
JMFF005O01+ GCAGNTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
rJMSF052O21- GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
                      ____________________________________________________________
consensus GCAGCTAAGAGCTTCCCTTAATAGCTTAAATTCCCTTAAATGTCTCTATACTTAGCACAC
 
. : . : . : . : . : . :
JMFS012A01+ TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF049N23- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF009I13- CCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF011G01- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF018G05- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
JMFN038A13+ TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF040P21- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF005O01- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF003H07- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF029P02- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF040N09- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF017I08- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMSF010L05- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMSF033F03- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTATAGACGGTGTATTTC
rJMSF037D01- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMSF008P17- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMSF002L20- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMFF025P05- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
JMFF005O01+ TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
rJMSF052O21- TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
                      ____________________________________________________________
consensus TCAATAGGAACCGTAGGGTATCTGGCCTTATCATAGCAGTAATTGTAGACGGTGTATTTC
 
. : . : . : . : . : . :
JMFS012A01+ TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF049N23- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF009I13- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF011G01- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF018G05- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
JMFN038A13+ TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF040P21- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF005O01- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF003H07- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF029P02- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF040N09- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF017I08- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMSF010L05- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMSF033F03- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMSF037D01- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMSF008P17- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMSF002L20- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMFF025P05- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
JMFF005O01+ TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
JMFN025D03+ TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
rJMSF052O21- TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
JMFN008J19+ G
                      ____________________________________________________________
consensus TGGCGAACCCATCGGAGTCTCCTGTACTGCTCGGCGTCTAGGTCTTGGAACGCCTTCTGG
 
. : . : . : . : . : . :
JMFS012A01+ TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF049N23- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF009I13- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF011G01- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF018G05- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
JMFN038A13+ TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF040P21- TCCCACCATCTCTTGCCAAATGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF005O01- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF003H07- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF029P02- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF040N09- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF017I08- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMSF010L05- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMSF033F03- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMSF037D01- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMSF008P17- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMSF002L20- TCCCACCATCCCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMFF025P05- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
JMFF005O01+ TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
JMFN025D03+ TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
rJMSF052O21- TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
JMFN008J19+ TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
                      ____________________________________________________________
consensus TCCCACCATCTCTTGCCAACTGTGTTGCACACCTGGACTTCTTGTGAGGTGGAGGCCATG
 
. : . : . : . : . : . :
JMFS012A01+ CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCC
rJMFF049N23- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF009I13- CAGCCGTCCACGTGGAAGGATGTGTANGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF011G01- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF018G05- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
JMFN038A13+ CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF040P21- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF005O01- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF003H07- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF029P02- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF040N09- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF017I08- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMSF010L05- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMSF033F03- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMSF037D01- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMSF008P17- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMSF002L20- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMFF025P05- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
JMFF005O01+ CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
JMFN025D03+ CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
rJMSF052O21- CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
JMFN008J19+ CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
JMFN006I15+ TGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
                      ____________________________________________________________
consensus CAGCCGTCCACGTGGAAGGATGTGTAGGATGCTATGAAGGGTGCTTTGGACCAGTCCGTC
 
. : . : . : . : . : . :
rJMFF049N23- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMFF009I13- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACANGCTGGAGTACAGCTT
rJMFF011G01- TTCTCCAGCCCTCCCCGAGTGGCCCAGGTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMFF018G05- TTCTCCAGCCCTCCCCNAGTG
JMFN038A13+ TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMFF040P21- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMFF005O01- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMFF003H07- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMFF029P02- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMFF040N09- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMFF017I08- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMSF010L05- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMSF033F03- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMSF037D01- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMSF008P17- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMSF002L20- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMFF025P05- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGCTCCACAGGCTGGAGTACAGCTT
JMFF005O01+ TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
JMFN025D03+ TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
rJMSF052O21- TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
JMFN008J19+ TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
JMFN006I15+ TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
JMFN005H21+ GGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
JMSF033F03+ GGCGTTCCACAGGCTGGAGTACAGCTT
JMFF049N23+ GGAGTACAGCTT
JMFS046G03+ CTGGAGTACAGCTT
JMSF052O21+ TCGGCGTTCCACAGGCTGGAGTACAGCTT
JMSF037D01+ GGCGTTCCACAGGCTGGAGTACAGCTT
                      ____________________________________________________________
consensus TTCTCCAGCCCTCCCCGAGTGGCCCA-GTCGTCGGCGTTCCACAGGCTGGAGTACAGCTT
 
. : . : . : . : . : . :
rJMFF049N23- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGG
rJMFF009I13- CATGGGCTGGTTGAAGGGGAACCTAANACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMFF011G01- CATGGGCTGGNTGAAGGGGAACCTAAGACCCAANTCCTTGGAGTTCTTGAAGATCCTAAT
JMFN038A13+ CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMFF040P21- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMFF005O01- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMFF003H07- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMFF029P02- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMFF040N09- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMFF017I08- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMSF010L05- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMSF033F03- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMSF037D01- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMSF008P17- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMSF002L20- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMFF025P05- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
JMFF005O01+ CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
JMFN025D03+ CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
rJMSF052O21- CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
JMFN008J19+ CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
JMFN006I15+ CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
JMFN005H21+ CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
JMSF033F03+ CATGGGCTGGTTGAAGGGGAACNTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
JMFF049N23+ CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTNGGAGTTCTGNAAGATCCTAAT
JMFF025P05+ TGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCNTAAT
JMFS046G03+ CATGGGCTGG-TGAAGGTGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
JMFF015B08+ CTTGAAGATCNTAAT
JMFF018G05+ CTAAT
JMFF017I08+ GAGTTCTTGAAGATCCTAAT
JMSF052O21+ CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
JMSF037D01+ CATGGGCTGGTTGAAGGGGAACNTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
                      ____________________________________________________________
consensus CATGGGCTGGTTGAAGGGGAACCTAAGACCCAAATCCTTGGAGTTCTTGAAGATCCTAAT
 
. : . : . : . : . : . :
rJMFF009I13- GGGTACATCGTCCACAAAGAACACAATACAGTACA
rJMFF011G01- GGGNACATCG
JMFN038A13+ GGGTACATCGTCCACAAAGAACACAATACAG
rJMFF040P21- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAA
rJMFF005O01- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMFF003H07- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMFF029P02- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMFF040N09- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMFF017I08- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMSF010L05- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMSF033F03- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMSF037D01- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMSF008P17- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMSF002L20- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMFF025P05- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFF005O01+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFN025D03+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
rJMSF052O21- GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFN008J19+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFN006I15+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFN005H21+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMSF033F03+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFF049N23+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFF025P05+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFS046G03+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFF015B08+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFF018G05+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFF017I08+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFF029P02+ TTCCAAAGAACAGAGTAGGAGTG
JMFS005H06+ ACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFF003H07+ CACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMFF011G01+ CAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMSF052O21+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
JMSF037D01+ GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
                      ____________________________________________________________
consensus GGGTACATCGTCCACAAAGAACACAATACAGTACATGTTCCAAAGAACAGAGTAGGAGTG
 
. : . : . : . : . : . :
rJMFF005O01- GAAGCCCTTTGTANGGTCAAA
rJMFF003H07- GAAGCCCTTTGTANGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
rJMFF029P02- GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
rJMFF040N09- GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
rJMFF017I08- GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
rJMSF010L05- GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
rJMSF033F03- GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
rJMSF037D01- GAAGCCCTTTGTA
rJMSF008P17- GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
rJMSF002L20- GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
rJMFF025P05- GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF005O01+ GAAGCCCTTTGTAGGGTCAAA
JMFN025D03+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
rJMSF052O21- GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFN008J19+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFN006I15+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFN005H21+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMSF033F03+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF049N23+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF025P05+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFS046G03+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF015B08+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF018G05+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF017I08+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF029P02+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFS005H06+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF003H07+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF040N09+ TCTCTGTTTCCTTGGCCGCC
JMFF011G01+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMSF052O21+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMSF037D01+ GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
JMFF009I13+ GTTTCCTTGGCCGCC
                      ____________________________________________________________
consensus GAAGCCCTTTGTAGGGTCAAACCAAAGGTAAATCCTCTGTTCTCTGTTTCCTTGGCCGCC
 
. : . : . : . : . : . :
rJMFF003H07- GG
rJMFF029P02- GGTGAACACATTGGTCTGAAGTATGTAANGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
rJMFF040N09- GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
rJMFF017I08- GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
rJMSF010L05- GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTT
rJMSF033F03- GGTGAACACATTGGTC
rJMSF008P17- GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTT
rJMSF002L20- GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCC
rJMFF025P05- G
JMFN025D03+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
rJMSF052O21- GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFN008J19+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFN006I15+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFN005H21+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMSF033F03+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF049N23+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF025P05+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFS046G03+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF015B08+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF018G05+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF017I08+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF029P02+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFS005H06+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF003H07+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF040N09+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF011G01+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMSF052O21+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMSF037D01+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
JMFF040P21+ CTGTTCCCCAAGAACTCAAA
JMSF010L05+ CCAAGAACTCAAA
JMFF009I13+ GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
                      ____________________________________________________________
consensus GGTGAACACATTGGTCTGAAGTATGTAAGGCTGCCCTGTCCTGTTCCCCAAGAACTCAAA
 
. : . : . : . : . : . :
rJMFF029P02- ATCTATCTCGTCGTGCTCCGCATTGTTCG
rJMFF040N09- ATCTATCTCGTCGTGCTCCGCATTGTTCGACG
rJMFF017I08- ATCTATCTCGTCGTGNTCCGCATTGTTCGAC
JMFN025D03+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
rJMSF052O21- ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFN008J19+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFN006I15+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFN005H21+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMSF033F03+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF049N23+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF025P05+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFS046G03+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF015B08+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF018G05+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF017I08+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF029P02+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFS005H06+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF003H07+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF040N09+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF011G01+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMSF052O21+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMSF037D01+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF040P21+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMSF010L05+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
JMFF009I13+ ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
                      ____________________________________________________________
consensus ATCTATCTCGTCGTGCTCCGCATTGTTCGACGATAAATAGAATGCTGTGACAACACCAGC
 
. : . : . : . : . : . :
JMFN025D03+ TGAGTCTCCTCCAACAAGC
rJMSF052O21- TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGG
JMFN008J19+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFN006I15+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFN005H21+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMSF033F03+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF049N23+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF025P05+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFS046G03+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF015B08+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF018G05+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF017I08+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF029P02+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFS005H06+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF003H07+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF040N09+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF011G01+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMSF052O21+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMSF037D01+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMFF040P21+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMSF010L05+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMSF002L20+ TCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
JMSF008P17+ T
JMFF009I13+ TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
                      ____________________________________________________________
consensus TGAGTCTCCTCCAACAAGCTTCATCCTCATGCTGAAATGCCCAAACTGGTAGGAGTTTTT
 
. : . : . : . : . : . :
JMFN008J19+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFN006I15+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFN005H21+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMSF033F03+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF049N23+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF025P05+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFS046G03+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF015B08+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF018G05+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF017I08+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF029P02+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFS005H06+ GGACTGAAACCCAGTCCCT
JMFF003H07+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF040N09+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF011G01+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMSF052O21+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMSF037D01+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF040P21+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMSF010L05+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMSF002L20+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMSF008P17+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF048L05+ CCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
JMFF009I13+ GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
                      ____________________________________________________________
consensus GGACTGAAACCCAGTCCCTGTGTTCCTGTCAAGAACAAGATCCACAGATCGGCCGCCATT
 
. : . : . : . : . : . :
JMFN008J19+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGG
JMFN006I15+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFN005H21+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMSF033F03+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFF049N23+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFF025P05+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFS046G03+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGA-ATAGTTCGTGGAGAATGGAACATC
JMFF015B08+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFF018G05+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFF017I08+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFF029P02+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAAAATC
JMFF003H07+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAAAATC
JMFF040N09+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFF011G01+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMSF052O21+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMSF037D01+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFF040P21+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMSF010L05+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMSF002L20+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMSF008P17+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFF048L05+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
JMFF009I13+ GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
                      ____________________________________________________________
consensus GATGTACTTGATGTGGTCTGAAGCCCAAGTTGGGACATAGTTCGTGGAGAATGGAACATC
 
. : . : . : . : . : . :
JMFN006I15+ CACTGGTCTCCTGGGTGCCGCACAAAGAACACCTAGTCCTAGGTTGAT
JMFN005H21+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMSF033F03+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF049N23+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF025P05+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFS046G03+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF015B08+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF018G05+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF017I08+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF029P02+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF003H07+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF040N09+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF011G01+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMSF052O21+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMSF037D01+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF040P21+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMSF010L05+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMSF002L20+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMSF008P17+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF048L05+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
JMFF009I13+ CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
                      ____________________________________________________________
consensus CACTGGTCTCCTGGGTGCCGCACAATGAACACCTAGTCCTAGGTTGATGAATACTAAGCC
 
. : . : . : . : . : . :
JMFN005H21+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMSF033F03+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF049N23+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF025P05+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFS046G03+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAACCCTATTGGAGAATGGAGAACAGCTC
JMFF015B08+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF018G05+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF017I08+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF029P02+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF003H07+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF040N09+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF011G01+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMSF052O21+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMSF037D01+ CAGAAATATGAGTTCGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF040P21+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMSF010L05+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMSF002L20+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMSF008P17+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF048L05+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
JMFF009I13+ CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
                      ____________________________________________________________
consensus CAGAAATATGAGTTTGCCCACCATTTTTGCCAAA-CCTATTGGAGAATGGAGAACAGCTC
 
. : . : . : . : . : . :
JMSF033F03+ TTTTAAGTAACTACTATA
JMFF049N23+ TTTTAAGTAACTACTATAAATAGCTT
JMFF025P05+ TTTTAAGTAACTACTATAAATAGCTT
JMFS046G03+ TTTTAAG
JMFF015B08+ TTTTAAGTAACTACTATAAAT
JMFF018G05+ TTTTAAGTAACTACTAT
JMFF017I08+ TTTTAAGTAACTACTATAAATAGCTT
JMFF029P02+ TTTTAAGTAACTACTATAAAT
JMFF003H07+ TTTTAAGTAACTACTATAAAT
JMFF040N09+ TTTTAAGTAACTACTATAAATAGCTT
JMFF011G01+ TTTTAAGTAACTACTATAAATAGCTT
JMSF052O21+ TTTTAAGTAACTACTATAAATAGCTT
JMSF037D01+ TTTTAAGTAACTACTATAAATAGCTT
JMFF040P21+ TTTTAAGTAACTACTATAAATAGCTT
JMSF010L05+ TTTTAAGTAACCACTATAAATAGCTT
JMSF002L20+ TTTTAAGTAACTACTATAAATAGCT
JMSF008P17+ TTTTAAGTAACTACTATAAATAGC
JMFF048L05+ TTTTAAGTAACTACTATAAATAGCTT
JMFF009I13+ TTTTAAGTAACTACTATAAATAGCTTAATAAAGCAAGCTTGGGCGTGGTGTATATATACT
                      ____________________________________________________________
consensus TTTTAAGTAACTACTATAAATAGCTTAATAAAGCAAGCTTGGGCGTGGTGTATATATACT