Previous Contig 000495:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009H06Sequence594000495 (6)gb:AF464906_18020241e-64Glycine max repressor protein (Dr1) mRNA, complete cds.687000495 (6)gb:AF464906_18020246e-53Glycine max repressor protein (Dr1) mRNA, complete cds.
JMFF036A05Sequence248000495 (6)gb:AY087017_15720534e-05Arabidopsis thaliana clone 30536 mRNA, complete sequence.>gb:AY125544_1580349 Ar503000495 (6)pir|S53582|S535824e-15TATA-binding protein-associated phosphoprotein Dr1 - Arabidopsis thaliana
JMFF038P18Sequence520000495 (6)gb:AF464906_18020247e-54Glycine max repressor protein (Dr1) mRNA, complete cds.
JMFN020D23Sequence305000495 (6)gb:AF464906_18020245e-42Glycine max repressor protein (Dr1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009H06- AGCCTATGTTGCAACTAACATCAA
                      ____________________________________________________________
consensus AGCCTATGTTGCAACTAACATCAA
 
. : . : . : . : . : . :
rJMFF036A05- CCAGATTTANATTGATGCTTAGATGAACTGAGTTCANGCAAGAGGAATACCCCTTTGGCA
rJMFF009H06- CCAGATTTAGATTGATGCTTAGATGAACTGAGTTCAGGCAAGAGGAATACCCCTTTGGCA
                      ____________________________________________________________
consensus CCAGATTTAGATTGATGCTTAGATGAACTGAGTTCAGGCAAGAGGAATACCCCTTTGGCA
 
. : . : . : . : . : . :
rJMFF036A05- CTTNCNCTGATACACCAAAGTTCCATGGCAAAACACTAACTACATAAACATATANACATA
rJMFF009H06- CTTACACTGATACACCAAAGTTCCATGGCAAAACACTAACTACATAAACATATAGACATA
                      ____________________________________________________________
consensus CTTACACTGATACACCAAAGTTCCATGGCAAAACACTAACTACATAAACATATAGACATA
 
. : . : . : . : . : . :
rJMFF036A05- AATTCATAAAGTACAANTAANGTCAAAAAGAGGGGNAGGCTANCTGGGAGATTTCTGTAC
rJMFF009H06- AATTCATAAAGTACAAGTAAGGTCAAAAAGAGGGGCAGGCTAGCTAAGAGATTTCTGTAC
                      ____________________________________________________________
consensus AATTCATAAAGTACAAGTAAGGTCAAAAAGAGGGGCAGGCTAGCTGGGAGATTTCTGTAC
 
. : . : . : . : . : . :
rJMFF036A05- ATGATNNTGCNAGACNGAATCCTAATAACTATGANNCAACAGATGATCTTGCCTAAACCT
rJMFF009H06- ATGATAATGCAAGACAGAATCCTAATAACTATGAAGCAACAGATGATCTTGCCTAAACCT
                      ____________________________________________________________
consensus ATGATAATGCAAGACAGAATCCTAATAACTATGAAGCAACAGATGATCTTGCCTAAACCT
 
. : . : . : . : . : . :
rJMFF036A05- ANNGATGGAGGNGTACATACGTTNGCAGNTTATTTATGTTCCGGCTCCGGGTCTGATTGT
rJMFF009H06- AAAGATGGAGGTGTACATACGTTAGCAGTTTATTTATGTTCCGGCTCCGGGTCTGATTGT
                      ____________________________________________________________
consensus AAAGATGGAGGTGTACATACGTTAGCAGTTTATTTATGTTCCGGCTCCGGGTCTGATTGT
 
. : . : . : . : . : . :
rJMFF036A05- NTGGGGACCANAATGCCGNTATTCATCCTTGTTCNTGCTTCTGCNAACATCCTCTGNTGC
JMFN020D23+ CCGTTATTCATCCTTGTTCGTGCTTCTGCAAACATCCTCTGTTGC
rJMFF009H06- TTGGGGACCACAATGCCGTTATTCATCCTTGTTCGTGCTTCTGCAAACATCCTCTGTTGC
JMFF009H06+ TATTCATCCTTGTTCGTGCTTCTGCAAACATCCTCTGTTGC
                      ____________________________________________________________
consensus TTGGGGACCACAATGCCGTTATTCATCCTTGTTCGTGCTTCTGCAAACATCCTCTGTTGC
 
. : . : . : . : . : . :
rJMFF036A05- TCANCCAACGCTTCTTCTTCNGTCATTTNNNCTACATTGTTCCACTCCCCNGNCCTGACN
JMFN020D23+ TCAGCCAACGCTTCTTCTTCGGTCATTTCAGCTACATTGTTCCACTTCCCAGCCCTGACG
rJMFF009H06- TCAGCCAACGCTTCTTCTTCGGTCATTTCAGCTACATTGTTCCACTCCCCAGCCCTGACG
JMFF038P18+ GGTCATTTCAGCTACATTGTTCCACTTCCCAGCCCTGACG
JMFF009H06+ TCAGCCAACGCTTCTTCTTCGGTCATTTCAGCTACATTGTTCCACTCCCCAGCCCTGACG
                      ____________________________________________________________
consensus TCAGCCAACGCTTCTTCTTCGGTCATTTCAGCTACATTGTTCCACTCCCCAGCCCTGACG
 
. : . : . : . : . : . :
rJMFF036A05- GNATCCATGGNTTCAAGCCTGTGCTGTTCATACGCAGCATAAACTTCTTCAATATAATCC
JMFN020D23+ GTATCCATGGTTTCAAGCCTGTGCTGTTCATACGCAGCATAAACTTCTTCAATATAATCC
rJMFF009H06- GTATCCATGGTTTCAAGCCTGTGCTGTTCATACGCAGCATAAACTTCTTCAATATAATCC
JMFF038P18+ GTATCCATGGTTTCAAGCCTGTGCTGTTCATACGCAGCATAAACTTCTTCAATATAATCC
JMFF009H06+ GTATCCATGGTTTCAAGCCTGTGCTGTTCATACGCAGCATAAACTTCTTCAATATAATCC
                      ____________________________________________________________
consensus GTATCCATGGTTTCAAGCCTGTGCTGTTCATACGCAGCATAAACTTCTTCAATATAATCC
 
. : . : . : . : . : . :
rJMFF036A05- CCAAAGC
JMFN020D23+ CCAAAGCCTAGGACCTCGAGGGCCTTGAGCACATGCTCAGGAGCAATTGTTCGTCTCTCT
rJMFF009H06- CCAAAGCCTAGGACCTCGAGGGCCTTGAGCACATGCTCAGGAGCAATTGTTCGTCTCTCT
JMFF038P18+ CCAAAGCCTAGGACCTCGAGGGCCTTGAGCACATGCTCAGGAGCAATTGTTCGTCTCTCT
JMFF009H06+ CCAAAGCCTAGGACCTCGAGGGCCTTGAGCACATGCTCAGGAGCAATTGTTCGTCTCTCT
                      ____________________________________________________________
consensus CCAAAGCCTAGGACCTCGAGGGCCTTGAGCACATGCTCAGGAGCAATTGTTCGTCTCTCT
 
. : . : . : . : . : . :
JMFN020D23+ TCTTTATTACAAACTTCATTTGATTCTGATGATATTAGATTAATAAATTCTACACAACAT
rJMFF009H06- TCTTTATTACAAACTTCATTTGATTCTGATGATATTAGATTAATAAATTCTACACAACAT
JMFF038P18+ TCTTTATTACAAACTTCATTTGATTCTGATGATATTAGATTAATAAATTCTACACAACAT
JMFF009H06+ TCTTTATTACAAACTTCATTTGATTCTGATGATATTAGATTAATAAATTCTACACAACAT
                      ____________________________________________________________
consensus TCTTTATTACAAACTTCATTTGATTCTGATGATATTAGATTAATAAATTCTACACAACAT
 
. : . : . : . : . : . :
JMFN020D23+ TCAA
rJMFF009H06- TCAATTAACAGATCCTGAGCATCTCGAGCAACACGAACATCTGGTGGTAGCATCTCTTTA
JMFF038P18+ TCAATTAACAGATCCTGAGCATCTCGAGCAACACGAACATCTGGTGGTAGCATCTCTTTA
JMFF036A05+ TCTTTA
JMFF009H06+ TCAATTAACAGATCCTGAGCATCTCGAGCAACACGAACATCTGGTGGTAGCATCTCTTTA
                      ____________________________________________________________
consensus TCAATTAACAGATCCTGAGCATCTCGAGCAACACGAACATCTGGTGGTAGCATCTCTTTA
 
. : . : . : . : . : . :
rJMFF009H06- ATA
JMFF038P18+ ATAATTTTTGTCATAGTTGCTTTGGGAAGCGAAGCATCCTCTTTCGATTTACCAACGATG
JMFF036A05+ ATAATTTTTGTCATAGTTGCTTTGGGAAGCGAAGCATCCTCTTTCGATTTACCAACGATG
JMFF009H06+ ATAATTTTTGTCATAGTTGCTTTGGGAAGCGAAGCATCCTCTTTCGATTTACCAACGATG
                      ____________________________________________________________
consensus ATAATTTTTGTCATAGTTGCTTTGGGAAGCGAAGCATCCTCTTTCGATTTACCAACGATG
 
. : . : . : . : . : . :
JMFF038P18+ TCCATCGATTCCATCTTATCCCTTGAAAAAAATCTGATTCAGAATCAAACTAACAAAGAT
JMFF036A05+ TCCATCGATNCCATCTTATCCCTTGAAAAANATCTGATTCAGAATCAAACTAACAAAGAT
JMFF009H06+ TCCATCGATTCCATCTTATCCCTTGAAAAAAATCTGATTCAGAATCAAACTAACAAAGAT
                      ____________________________________________________________
consensus TCCATCGATTCCATCTTATCCCTTGAAAAAAATCTGATTCAGAATCAAACTAACAAAGAT
 
. : . : . : . : . : . :
JMFF038P18+ CTTACAAAAACTAGAAGATCGGACAGGAGAATGGAAAAAATTAAAAATCCGGCAAAGGTT
JMFF036A05+ CTTACAAAAACTAGAAGATCGGACAGGAGAATGGAAAAAATTAAAAATCCGGCAAAGGTT
JMFF009H06+ CTTACAAAAACTAGAAGATCGGACAGGAGAATGGAAAAAATTAAAAATCCGGCAAAGGTT
                      ____________________________________________________________
consensus CTTACAAAAACTAGAAGATCGGACAGGAGAATGGAAAAAATTAAAAATCCGGCAAAGGTT
 
. : . : . : . : . : . :
JMFF038P18+ CGGCCGATTAGAGGAGAAGTAGCAGTGGTTGCCGGTGGTGGTGCAGGTGATGGTGAATAT
JMFF036A05+ CGGCCGATTAGAGGAGAAGTAGCAGTGGTTGCCGGTGGTGGTGCAGGTGATGGTGAATAT
JMFF009H06+ CGGCCGATTAGAGGAGAAGTAGCAGTGGTTGCCGGTGGTGGTGCAGGTGATGGTGAATAT
                      ____________________________________________________________
consensus CGGCCGATTAGAGGAGAAGTAGCAGTGGTTGCCGGTGGTGGTGCAGGTGATGGTGAATAT