Previous Contig 000488:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009F14Sequence555000488 (3)pir|T06014|T060144e-12arginine-tRNA ligase (EC 6.1.1.19) - Arabidopsis thaliana>gb:CQ789555_1452859 Se679008599 (3)gb:AX366207_14663284e-75Sequence 1 from Patent WO0200696.>gb:ATARGSG7_1544077 Arabidopsis thaliana gene
JMFF037F03Sequence573000488 (3)pir|T06014|T060148e-15arginine-tRNA ligase (EC 6.1.1.19) - Arabidopsis thaliana>gb:CQ789555_1452859 Se729008599 (3)gb:AX366207_14663281e-82Sequence 1 from Patent WO0200696.>gb:ATARGSG7_1544077 Arabidopsis thaliana gene
JMSF015M04Sequence527000488 (3)gb:AX366207_14663285e-10Sequence 1 from Patent WO0200696.>gb:ATARGSG7_1544077 Arabidopsis thaliana gene 743008599 (3)gb:AX366207_14663288e-87Sequence 1 from Patent WO0200696.>gb:ATARGSG7_1544077 Arabidopsis thaliana gene

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF037F03+ GAACTGAGTACCCTTCACTTTAATTTTAGCCCATAAG
JMSF015M04+ CCCATAAG
JMFF009F14+ CCCATAAG
                      ____________________________________________________________
consensus GAACTGAGTACCCTTCACTTTAATTTTAGCCCATAAG
 
. : . : . : . : . : . :
JMFF037F03+ CTCATGGCATTGTTACATTGATAGTCTCCAAATTTGGGATTGTTGCAAATAGCCATCATT
JMSF015M04+ CTCATGCCATTGTTACATTGATAGTCTCCAAATTTGGGATTGTTGCAAATAGCCATCATT
JMFF009F14+ CTCATGGCATTGTTACATTGATAGTCTCCAAATTTGGGATTGTTGCAAATAGCCATCATT
                      ____________________________________________________________
consensus CTCATGGCATTGTTACATTGATAGTCTCCAAATTTGGGATTGTTGCAAATAGCCATCATT
 
. : . : . : . : . : . :
JMFF037F03+ GGTTGTACATCCGATTCATCAGGAAACGTTGCTCTAAGAGATTCTTCAAATAATTTTGCT
JMSF015M04+ GGTTGTACATCCGATTCATCAGGAAACGTTGCTCTAAGAGATTCTTCAAATAATTTTGCT
JMFF009F14+ GGTTGTACATCCGATTCATCAGGAAACGTTGCTCTAAGAGATTCTTCAAATAATTTTGCT
                      ____________________________________________________________
consensus GGTTGTACATCCGATTCATCAGGAAACGTTGCTCTAAGAGATTCTTCAAATAATTTTGCT
 
. : . : . : . : . : . :
JMFF037F03+ AATTGCTCTTTAACACTCCCCACAGCTGTCATGGTTGAAATCGGTGTTGCTGTTACTTTC
JMSF015M04+ AATTGCTCTTTAACACTCCCCACAGCTGTCATGGTTGAAATCGGTGTTGCTGTTACTTTC
JMFF009F14+ AATTGCTCTTTAACACTCCCCACAGCTGTCATGGTTGAAATCGGTGTTGCTGTTACTTTC
                      ____________________________________________________________
consensus AATTGCTCTTTAACACTCCCCACAGCTGTCATGGTTGAAATCGGTGTTGCTGTTACTTTC
 
. : . : . : . : . : . :
JMFF037F03+ CCCACACTACGAAATCTACTAGATGTAGATCTGAGTGTAC----CGTTGTTACTCATTAG
JMSF015M04+ CCCACACTACGAAATCTACTAGATGTAGATCTGAGTGTACCTGTCGTTGTTACTCATTAG
JMFF009F14+ CCCACACTACGAAATCTACTAGATGTAGATCTGAGTGTAC----CGTTGTTACTCATTAG
                      ____________________________________________________________
consensus CCCACACTACGAAATCTACTAGATGTAGATCTGAGTGTAC----CGTTGTTACTCATTAG
 
. : . : . : . : . : . :
JMFF037F03+ ATTTTCTAGGCTGGAGGCTTTGACGATTTGATGGTGGCCATTGAGTAGCATACCGGCGGA
JMSF015M04+ ATTTTCTAGGCTGGAGGCTTTGACGATTTGATGGTGGCCATTGAGTAGCATACCGGCGGA
JMFF009F14+ ATTTTCTAGGCTGGAGGCTTTGACGATTTGATGGTGGCCATTGAGTAGCATACCGGCGGA
                      ____________________________________________________________
consensus ATTTTCTAGGCTGGAGGCTTTGACGATTTGATGGTGGCCATTGAGTAGCATACCGGCGGA
 
. : . : . : . : . : . :
JMFF037F03+ GCGCTCACATGTGGAAGAAATATAGGGTTTCCGGGAGCGATTGAGCGACGATAGGACGAA
JMSF015M04+ GCGCTCACATGTGGAAGAAATATAGGGTTTCCGGGAGCGATTGAGCGACGATAGGACGAA
JMFF009F14+ GCGCTCACATGTGGAAGAAATATAGGGTTTCCGGGAGCGATTGAGCGACGATAGGACGAA
                      ____________________________________________________________
consensus GCGCTCACATGTGGAAGAAATATAGGGTTTCCGGGAGCGATTGAGCGACGATAGGACGAA
 
. : . : . : . : . : . :
JMFF037F03+ GGTGCAGACGACACTCGAGATGACAGAGAGCCGGAGATGGAGTCAGAGGAGTGAGAGGCG
JMSF015M04+ GGTGCAGACGACACTCGAGATGACAGAGAGCCGGAGATGGAGTCAGAGGAGTGAGAGGCG
JMFF009F14+ GGTGCAGACGACACTCGAGATGACAGAGAGCCGGAGATGGAGTCAGAGGAGTGAGAGGCG
                      ____________________________________________________________
consensus GGTGCAGACGACACTCGAGATGACAGAGAGCCGGAGATGGAGTCAGAGGAGTGAGAGGCG
 
. : . : . : . : . : . :
JMFF037F03+ GAGAGCCGGAACAGGGATGGGTTTAGGGTTTAGGCGAAGCTCCCTCTCCGATTCTTTTGG
JMSF015M04+ GAGAGCCGGAACAGGGATGGGTTTAGGGTTTAGGCGAAGCTCCCTCTCCGATTCTTTTGG
JMFF009F14+ GAGAGCCGGAACAGGGATGGGTTTAGGGTTTAGGCGAAGCTCCCTCTCCGATTCTTTTGG
                      ____________________________________________________________
consensus GAGAGCCGGAACAGGGATGGGTTTAGGGTTTAGGCGAAGCTCCCTCTCCGATTCTTTTGG
 
. : . : . : . : . : . :
JMFF037F03+ CTCCAAATTCAGAATGTAATACTACTTCCCAGTTCCCATTTCGGAGAAGAGAGTTTAATT
JMSF015M04+ CTCCAAATTCAGAATGTAATACTACTTCCC
JMFF009F14+ CTCCAAATTCAGAATGTAATACTACTTCCCAGTTCCCATTTCGGAGAAGAGAGTTTAATT
                      ____________________________________________________________
consensus CTCCAAATTCAGAATGTAATACTACTTCCCAGTTCCCATTTCGGAGAAGAGAGTTTAATT