Previous Contig 000480:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009D03Sequence545000480 (3)pir|C96732|C967327e-17hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946750008593 (3)pir|C96732|C967322e-17hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMFF016N10Sequence605000480 (3)pir|C96732|C967324e-26hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946794008593 (3)pir|C96732|C967322e-21hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMSF012B07Sequence420000480 (3)pir|C96732|C967321e-13hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946764008593 (3)pir|C96732|C967322e-42hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF016N10+ CTGTGAAGCAGTC
                      ____________________________________________________________
consensus CTGTGAAGCAGTC
 
. : . : . : . : . : . :
JMFF016N10+ ACAGCTGAAAATGCTCGTCCAAAGTAATCCGCAAATCTCATCAACTGTATATCTTGTTGT
JMFF009D03+ GTTGT
                      ____________________________________________________________
consensus ACAGCTGAAAATGCTCGTCCAAAGTAATCCGCAAATCTCATCAACTGTATATCTTGTTGT
 
. : . : . : . : . : . :
JMFF016N10+ GATTCAAAAGTCGCAGAAACGTCAGCAAGGAAAACCGATAGATCATCGGCATCTATCTTG
JMFF009D03+ GATTCAAAAGTCGCAGAAACGTCAGCAAGGAAAACCGATAGATCATCGGCATCTATCTTG
                      ____________________________________________________________
consensus GATTCAAAAGTCGCAGAAACGTCAGCAAGGAAAACCGATAGATCATCGGCATCTATCTTG
 
. : . : . : . : . : . :
JMFF016N10+ GCGGCGGCTTCAGCCACAGTGACCTTCGGCTTCTTCTGCTTCTCCTTCTTCTTCTCATCC
JMSF012B07+ TCAGCCACAGTGACCTTCGGCTTCTTCTGCTTCTCCTTCTTCTTCTCATCC
JMFF009D03+ GCGGCGGCTTCAGCCACAGTGACCTTCGGCTTCTTCTGCTTCTCCTTCTTCTTCTCATCC
                      ____________________________________________________________
consensus GCGGCGGCTTCAGCCACAGTGACCTTCGGCTTCTTCTGCTTCTCCTTCTTCTTCTCATCC
 
. : . : . : . : . : . :
JMFF016N10+ GCAGCTCCATTCTGCATGGCTCCGCCTTCCAAATCGCTATCCTCGTCATCGGAACGATTC
JMSF012B07+ GCAGCTCCATTCTGCATGGCTCCGCCTTCCAAATCGCTATCCTCGTCATCGGAACGATTC
JMFF009D03+ GCAGCTCCATTCTGCATGGCTCCGCCTTCCAAATCGCTATCCTCGTCATCGGAACGATTC
                      ____________________________________________________________
consensus GCAGCTCCATTCTGCATGGCTCCGCCTTCCAAATCGCTATCCTCGTCATCGGAACGATTC
 
. : . : . : . : . : . :
JMFF016N10+ CTCGTGGCTGATCTCACAGGAGCATCGTCGTTAGCATTCATCGCGGCATAATGAGCTTCA
JMSF012B07+ CTCGTGGCTGATCTCACAGGAGCATCGTCGTTAGCATTCATCGCGGCATAATGAGCTTCA
JMFF009D03+ CTCGTGGCTGATCTCACAGGAGCATCGTCGTTAGCATTCATCGCGGCATAATGAGCTTCA
                      ____________________________________________________________
consensus CTCGTGGCTGATCTCACAGGAGCATCGTCGTTAGCATTCATCGCGGCATAATGAGCTTCA
 
. : . : . : . : . : . :
JMFF016N10+ ATTTTGCGGCGCCGCTCCTCGGCATGCTTCTCCAGCGACCCGAACACATTGTCCGCGCCG
JMSF012B07+ ATTTTGCGGCGCCGCTCCTCGGCATGCTTCTCCAGCGACCCGAACACATTGTCCGCGCCG
JMFF009D03+ ATTTTGCGGCGCCGCTCCTCGGCATGCTTCTCCAGCGACCCGAACACATTGTCCGCGCCG
                      ____________________________________________________________
consensus ATTTTGCGGCGCCGCTCCTCGGCATGCTTCTCCAGCGACCCGAACACATTGTCCGCGCCG
 
. : . : . : . : . : . :
JMFF016N10+ GATGCGCCGGATCCATTGGTGACCGTGATCCTCGAGGAATCCGTCGACGGTTTCTGCTGA
JMSF012B07+ GATGCGCCGGATCCATTGGTGACCGTGATCCTCGAGGAATCCGTCGACGGTTTCTGCTGA
JMFF009D03+ GATGCGCCGGATCCATTGGTGACCGTGATCCTCGAGGAATCCGTCGACGGTTTCTGCTGA
                      ____________________________________________________________
consensus GATGCGCCGGATCCATTGGTGACCGTGATCCTCGAGGAATCCGTCGACGGTTTCTGCTGA
 
. : . : . : . : . : . :
JMFF016N10+ TTCTTCTTCTGCTTCTTTGCATACGACACCTTTTTCCATCCATGGTCGCTGTTACTGACT
JMSF012B07+ TTCTTCTTCTGCTTCTTTGCATACGACACCTTTTTCCATCCATGGTCGCTGTTACTGACT
JMFF009D03+ TTCTTCTTCTGCTTCTTTGCATACGACACCTTTTTCCATCCATGGTCGCTGTTACTGACT
                      ____________________________________________________________
consensus TTCTTCTTCTGCTTCTTTGCATACGACACCTTTTTCCATCCATGGTCGCTGTTACTGACT
 
. : . : . : . : . : . :
JMFF016N10+ TCGATGCCGAAGACTTCGAGAGGCATGGATTTCTCTTCCATTTTCAGAGGGGATCGAAGA
JMSF012B07+ TCGATGCCGAAGACTTCGAGAGGCATGGATTTCTCTTCCATTTTCAGAGGGGATCGAAGA
JMFF009D03+ TCGATGCCGAAGACTTCGAGAGGCATGGATTTCTCTTCCATTTTCAGAGGGGATCGAAGA
                      ____________________________________________________________
consensus TCGATGCCGAAGACTTCGAGAGGCATGGATTTCTCTTCCATTTTCAGAGGGGATCGAAGA
 
. : . : . : . : . : . :
JMFF016N10+ CAAACTTTGGGGAAAGAGATCGCAGAAAACGGGAAGTGAAGGACAGGAAAGT
JMSF012B07+ CAAACTTT
JMFF009D03+ CAAACTTTGGGGAAAGAGATCGCAGAAAACGGGAAGTGAAGGACAGGAAAGTGGAGAAAG
                      ____________________________________________________________
consensus CAAACTTTGGGGAAAGAGATCGCAGAAAACGGGAAGTGAAGGACAGGAAAGTGGAGAAAG