Previous Contig 000468:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008P20Sequence575000468 (2)gb:AB084464_15243426e-64Pyrus communis PC-EG2 mRNA for endo-1,4-beta-D-glucanase, complete cds.695009905 (3)gb:AF098292_17679123e-41Lycopersicon esculentum endo-beta-1,4-D-glucanase (Cel8) mRNA, complete cds.
JMFF036G16Sequence582000468 (2)gb:AB084464_15243429e-65Pyrus communis PC-EG2 mRNA for endo-1,4-beta-D-glucanase, complete cds.697009905 (3)gb:AF098292_17679123e-41Lycopersicon esculentum endo-beta-1,4-D-glucanase (Cel8) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036G16+ TCCGCATATCCACTAACGGATTGGTAGTATCTCTGTGCGACG
JMFF008P20+ ATCCACTAACGGATTGGTAGTATCTCTGTGCGACG
                      ____________________________________________________________
consensus TCCGCATATCCACTAACGGATTGGTAGTATCTCTGTGCGACG
 
. : . : . : . : . : . :
JMFF036G16+ GTTATGCTGCTGTCATATTTGCCCCGGTACTTGTCCGCAAACTCAAACAGCTGGTAGGCG
JMFF008P20+ GTTATGCTGCTGTCATATTTGCCCCGGTACTTGTCCGCAAACTCAAACAGCTGGTAGGCG
                      ____________________________________________________________
consensus GTTATGCTGCTGTCATATTTGCCCCGGTACTTGTCCGCAAACTCAAACAGCTGGTAGGCG
 
. : . : . : . : . : . :
JMFF036G16+ TGCTGGAGCAGCTCATTGGAGTAGGAAGGGTTGGAGCGGCGGAAGACGATGGATGCGGCG
JMFF008P20+ TGCTGGAGCAGCTCATTGGAGTAGGAAGGGTTGGAGCGGCGGAAGACGATGGATGCGGCG
                      ____________________________________________________________
consensus TGCTGGAGCAGCTCATTGGAGTAGGAAGGGTTGGAGCGGCGGAAGACGATGGATGCGGCG
 
. : . : . : . : . : . :
JMFF036G16+ GCCATGGCGGCGGCGGTCTCGCCGGCGAGGTCTGATCCCGGCCGGCTTGGGTCGATCTTG
JMFF008P20+ GCCATGGCGGCGGCGGTCTCGCCGGCGAGGTCTGATCCCGGCCGGCTTGGGTCGATCTTG
                      ____________________________________________________________
consensus GCCATGGCGGCGGCGGTCTCGCCGGCGAGGTCTGATCCCGGCCGGCTTGGGTCGATCTTG
 
. : . : . : . : . : . :
JMFF036G16+ TAAGCCGTCCTTGAAGTCGTCATGTCCTCCGGCCTCTGCCAGCAGAAATGGTCGGTTCAC
JMFF008P20+ TAAGCCGTCCTTGAAGTCGTCATGTCCTCCGGCCTCTGCCAGCAGAAATGGTCGGTTCAC
                      ____________________________________________________________
consensus TAAGCCGTCCTTGAAGTCGTCATGTCCTCCGGCCTCTGCCAGCAGAAATGGTCGGTTCAC
 
. : . : . : . : . : . :
JMFF036G16+ CATCTCCCACCTCTCCATAGAGGACGTTGGGTTCAGGGTGAGCTTTGATGAAGTAGTCGG
JMFF008P20+ CATCTCCCACCTCTCCATAGAGGACGTTGGGTTCAGGGTGAGCTTTGATGAAGTAGTCGG
                      ____________________________________________________________
consensus CATCTCCCACCTCTCCATAGAGGACGTTGGGTTCAGGGTGAGCTTTGATGAAGTAGTCGG
 
. : . : . : . : . : . :
JMFF036G16+ TGCCCCACTTAACGGCGTCCATGGCGTGGCCAAGCTCCCCACTGGCCGCCATTTGTTTGC
JMFF008P20+ TGCCCCACTTAACGGCGTCCATGGCGTGGCCAAGCTCCCCACTGGCCGCCATTTGTTTGC
                      ____________________________________________________________
consensus TGCCCCACTTAACGGCGTCCATGGCGTGGCCAAGCTCCCCACTGGCCGCCATTTGTTTGC
 
. : . : . : . : . : . :
JMFF036G16+ CATATTCGATGATACTCCAGGACATCATAGATCCTGATCTTTGGATCTGGCACACCACGG
JMFF008P20+ CATATTCGATGATACTCCAGGACATCATAGATCCTGATCTTTGGATCTGGCACACCACGG
                      ____________________________________________________________
consensus CATATTCGATGATACTCCAGGACATCATAGATCCTGATCTTTGGATCTGGCACACCACGG
 
. : . : . : . : . : . :
JMFF036G16+ CAGTACCTTGATTTCGGGTAAGGCTTGTTCTTAATCTGACGGTAACACCTTGCTGGTCTT
JMFF008P20+ CAGTACCTTGATTTCGGGTAAGGCTTGTTCTTAATCTGACGGTAACACCTTGCTGGTCTT
                      ____________________________________________________________
consensus CAGTACCTTGATTTCGGGTAAGGCTTGTTCTTAATCTGACGGTAACACCTTGCTGGTCTT
 
. : . : . : . : . : . :
JMFF036G16+ CTTCCCATGGCGACGTCTGCTTGCGGCTCGGCTGATCTGCGGCAAATCGAAGTGAAAAAC
JMFF008P20+ CTTCCCATGGCGACGTCTGCTTGCGGCTCGGCTGATCTGCGGCAAATCGAAGTGAAAAAC
                      ____________________________________________________________
consensus CTTCCCATGGCGACGTCTGCTTGCGGCTCGGCTGATCTGCGGCAAATCGAAGTGAAAAAC