Previous Contig 000466:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008P12Sequence562000466 (2)gb:AB017060_15133012e-37Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18J17.727020838gb:AB017060_15133011e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18J17.
JMFS054H05Sequence631000466 (2)gb:AP005829_18586262e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B100

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS054H05+ TAACCAACAAGTGTCTGCTAATCCTAGAATAATCGAG
                      ____________________________________________________________
consensus TAACCAACAAGTGTCTGCTAATCCTAGAATAATCGAG
 
. : . : . : . : . : . :
JMFS054H05+ CACTCTCAGAACCTGCTCATTAGGATCCTTGAGTTCAGCAGCCCTAGCACCAGAAGCAAG
                      ____________________________________________________________
consensus CACTCTCAGAACCTGCTCATTAGGATCCTTGAGTTCAGCAGCCCTAGCACCAGAAGCAAG
 
. : . : . : . : . : . :
JMFS054H05+ GTTGTGAAGTATAAGATCCCCATTAAGGCTGATAGAAGCTAGGTGCTCATCTTTACAATT
                      ____________________________________________________________
consensus GTTGTGAAGTATAAGATCCCCATTAAGGCTGATAGAAGCTAGGTGCTCATCTTTACAATT
 
. : . : . : . : . : . :
JMFS054H05+ GTACATTGCACCAGTTATTGTATCACTATGACCTTTCAACCATTTAATGCATCGTTTCCG
JMFF008P12+ AACCATTTAATGCATCGTTTCCG
                      ____________________________________________________________
consensus GTACATTGCACCAGTTATTGTATCACTATGACCTTTCAACCATTTAATGCATCGTTTCCG
 
. : . : . : . : . : . :
JMFS054H05+ CTGCAAATCCCATATTCTAACAACTTGACCACTTCCTCCAGAACAAAGATATCTTGATCC
JMFF008P12+ CTGC-AATCCCATATTCTAACAACTTGACCACTTCCTCCAGAACAAAGATATCTTGATCC
                      ____________________________________________________________
consensus CTGCAAATCCCATATTCTAACAACTTGACCACTTCCTCCAGAACAAAGATATCTTGATCC
 
. : . : . : . : . : . :
JMFS054H05+ TTTATTGTTAAAGTTGATGGTAGAAATGGATTCCTCGATACTATCACCACTATCGCTGCC
JMFF008P12+ TTTATTGTTAAAGTTGATGGTAGAAATGGATTCCTCGATACTGTCACCACTATCGCTGCC
                      ____________________________________________________________
consensus TTTATTGTTAAAGTTGATGGTAGAAATGGATTCCTCGATACTGTCACCACTATCGCTGCC
 
. : . : . : . : . : . :
JMFS054H05+ TGCTGCCGGAATAGTCCCCAGCGTCTGCCCATTCTTTCTCCACAAGGAAATCTTCTTGTC
JMFF008P12+ TGCTGCCGGAATAGTCCCCAGCGTCTGCCCATTCTTTCTCCACAAGGAAATCTTCTTGTC
                      ____________________________________________________________
consensus TGCTGCCGGAATAGTCCCCAGCGTCTGCCCATTCTTTCTCCACAAGGAAATCTTCTTGTC
 
. : . : . : . : . : . :
JMFS054H05+ GTCTCCGGCACTAGCCACCACCAAATTGGTGTGGCTCCACTTGACGGAGTTAACTTGCGA
JMFF008P12+ GTCTCCGGCACTAGCCACCACCAAATTGGTGTGGCTCCACTTGACGGAGTTAACTTGCGA
                      ____________________________________________________________
consensus GTCTCCGGCACTAGCCACCACCAAATTGGTGTGGCTCCACTTGACGGAGTTAACTTGCGA
 
. : . : . : . : . : . :
JMFS054H05+ GCCCGGAGACGGAGTGTAGGTGAGAATGCAGGTGTCGCGAGGCTCCAACGAGAGGTCGAA
JMFF008P12+ GCCCGGAGACGGAGTGTAGGTGAGAATGCAGGTGTCGCGAGGCTCCAACGAGAGGTCGAA
                      ____________________________________________________________
consensus GCCCGGAGACGGAGTGTAGGTGAGAATGCAGGTGTCGCGAGGCTCCAACGAGAGGTCGAA
 
. : . : . : . : . : . :
JMFS054H05+ GAGCTTCACGGTGTCGCCGCCGCCAGCGGCCAATAGTGCCTTTATCGAATCCGTGGAATT
JMFF008P12+ GAGCTTCACGGTGTCGCCGCCGCCAGCGGCCAATAGTGCCTTTATCGAATCCGTGGAATT
                      ____________________________________________________________
consensus GAGCTTCACGGTGTCGCCGCCGCCAGCGGCCAATAGTGCCTTTATCGAATCCGTGGAATT
 
. : . : . : . : . : . :
JMFS054H05+ CATCTGCCGCCCTGCGATGCGGGTTTAGAGTGTACGTATACAATTATGAGTGAA
JMFF008P12+ CATCTGCCGCCCTGCGATGCGGGTTTAGAGTGTACGTATACAATTATGAGTGAAATTATA
                      ____________________________________________________________
consensus CATCTGCCGCCCTGCGATGCGGGTTTAGAGTGTACGTATACAATTATGAGTGAAATTATA
 
. : . : . : . : . : . :
JMFF008P12+ GCTCCGGCGGATTTGAATTTGCAGTGAAGTAATCAAGTGAAAACAGAAACAACAAAAACA
                      ____________________________________________________________
consensus GCTCCGGCGGATTTGAATTTGCAGTGAAGTAATCAAGTGAAAACAGAAACAACAAAAACA
 
. : . : . : . : . : . :
JMFF008P12+ AAAACAAAACAAAAAAACTGGGAATTTTTGGAGCTGTGGAGCGAAAAGAGCAGCCTTAGC
                      ____________________________________________________________
consensus AAAACAAAACAAAAAAACTGGGAATTTTTGGAGCTGTGGAGCGAAAAGAGCAGCCTTAGC