Previous Contig 000461:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008N12Sequence604000461 (3)gb:AP003871_18345903e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11670000461 (3)gb:AP003871_18345906e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFN008L12Sequence625000461 (3)gb:AP003871_18345904e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008N12- ATTATGATGAAAATTAACACTT
                      ____________________________________________________________
consensus ATTATGATGAAAATTAACACTT
 
. : . : . : . : . : . :
rJMFF008N12- ACATTGACGAATGGAATTACAAGAAACAAAAGGGACAGCCTTGATTAAGATAATATAATT
                      ____________________________________________________________
consensus ACATTGACGAATGGAATTACAAGAAACAAAAGGGACAGCCTTGATTAAGATAATATAATT
 
. : . : . : . : . : . :
rJMFF008N12- ACCCACATTACTAAATTCTCTTATAATCAAGAGATTAAATGTTTAAAAATGGGTTAACCC
                      ____________________________________________________________
consensus ACCCACATTACTAAATTCTCTTATAATCAAGAGATTAAATGTTTAAAAATGGGTTAACCC
 
. : . : . : . : . : . :
rJMFF008N12- TTGCCACGAACCCAGCCGGCCGGCCGGCGAACTGAAAGTCTGAAACATACTGCCGATCAG
JMFN008L12+ AG
                      ____________________________________________________________
consensus TTGCCACGAACCCAGCCGGCCGGCCGGCGAACTGAAAGTCTGAAACATACTGCCGATCAG
 
. : . : . : . : . : . :
rJMFF008N12- CCAAATTCGCTCTCTTCCATTTTTCTCACTATTTCTGCTTCGATTTTCTACGCTACGAAT
JMFN008L12+ CCAAATTCGCTCTCTTCCATTTTTCTCACTATTTCTGCTTCGATTTTCTACGCTACGAAT
JMFF008N12+ GAAT
                      ____________________________________________________________
consensus CCAAATTCGCTCTCTTCCATTTTTCTCACTATTTCTGCTTCGATTTTCTACGCTACGAAT
 
. : . : . : . : . : . :
rJMFF008N12- ACGCAAATCATTAAACTTTTTTTTGGAGAAGAAAAATTTACAAACTGATTATATACCATA
JMFN008L12+ ACGCAAATCATTAAAC-TTTTTTTGGAGAAGAAAAATTTACAAACTGATTATATACCATA
JMFF008N12+ ACGCAAATCATTAAACTTTTTTTTGGAGAAGAAAAATTTACAAACTGATTATATACCATA
                      ____________________________________________________________
consensus ACGCAAATCATTAAACTTTTTTTTGGAGAAGAAAAATTTACAAACTGATTATATACCATA
 
. : . : . : . : . : . :
rJMFF008N12- AGAACAATAGAGCCGAGAACATGGGAATCCGCCTCCTCCGCCACTTGACGACGGTTACAA
JMFN008L12+ AGAACAATAGAGCCGAGAACATGGGAATCCGCCTCCTCCGCCACTTGACGACGGTTACAA
JMFF008N12+ AGAACAATAGAGCCGAGAACATGGGAATCCGCCTCCTCCGCCACTTGACGACGGTTACAA
                      ____________________________________________________________
consensus AGAACAATAGAGCCGAGAACATGGGAATCCGCCTCCTCCGCCACTTGACGACGGTTACAA
 
. : . : . : . : . : . :
rJMFF008N12- GCCGGCCCGGCCCAATCGCCGCTCAACACGCATAGAAATCCACCAACTCATCCAGAGATT
JMFN008L12+ GCCGGCCCGGCCCAATCGCCGCTCAACACGCATAGAAATCCACCAACTCATCCAGAGATT
JMFF008N12+ GCCGGCCCGGCCCAATCGCCGCTCAACACGCATAGAAATCCACCAACTCATCCAGAGATT
                      ____________________________________________________________
consensus GCCGGCCCGGCCCAATCGCCGCTCAACACGCATAGAAATCCACCAACTCATCCAGAGATT
 
. : . : . : . : . : . :
rJMFF008N12- CCGGCTGGGGATCCGCATTCTCCAACATCCACAGCAGGTGCTCGAACAGCACGACTTCGC
JMFN008L12+ CCGGCTGGGGATCCGCATTCTCCAACATCCACAGCAGGTGCTCGAACAGCACGACTTCGC
JMFF008N12+ CCGGCTGGGGATCCGCATTCTCCAACATCCACAGCAGGTGCTCGAACAGCACGACTTCGC
                      ____________________________________________________________
consensus CCGGCTGGGGATCCGCATTCTCCAACATCCACAGCAGGTGCTCGAACAGCACGACTTCGC
 
. : . : . : . : . : . :
rJMFF008N12- AGCCGACGACGGTGACGGAATTGTCCGCGTCGTCGCCGGAGCGGTCCACCAGCTCGCGGA
JMFN008L12+ AGCCGACGACGGTGACGGAATTGTCCGCGTCGTCGCCGGAGCGGTCCACCAGCTCGCGGA
JMFF008N12+ AGCCGACGACGGTGACGGAATTGTCCGCGTCGTCGCCGGAGCGGTCCACCAGCTCGCGGA
                      ____________________________________________________________
consensus AGCCGACGACGGTGACGGAATTGTCCGCGTCGTCGCCGGAGCGGTCCACCAGCTCGCGGA
 
. : . : . : . : . : . :
rJMFF008N12- CCAGCGGATGTTCGATGACGCTCGAGCTGACGAGGTACCGGCGGCGAGATTTCCCGACGT
JMFN008L12+ CCAGCGGATGTTCGATGACGCTCGAGCTGACGAGGTACCGGCGGCGAGATTTCCCGACGT
JMFF008N12+ CCAGCGGATGTTCGATGACGCTCGAGCTGACGAGGTACCGGCGGCGAGATTTCCCGACGT
                      ____________________________________________________________
consensus CCAGCGGATGTTCGATGACGCTCGAGCTGACGAGGTACCGGCGGCGAGATTTCCCGACGT
 
. : . : . : . : . : . :
rJMFF008N12- AGACCGGGCGGAGATCCTTGGCGTAGCTGTTGTTATTGTTATTGCTAG
JMFN008L12+ AGACCGGGCGGAGATCCTTGGCGTAGCTGTTGTTATTGTTATTGCTAGACTCGTCGTCGG
JMFF008N12+ AGACCGGGCGGAGATCCTTGGCGTAGCTGTTGTTATTGTTATTGCTAGACTCGTCGTCGG
                      ____________________________________________________________
consensus AGACCGGGCGGAGATCCTTGGCGTAGCTGTTGTTATTGTTATTGCTAGACTCGTCGTCGG
 
. : . : . : . : . : . :
JMFN008L12+ AAGAGGCGGTGGCGGCGGCGGCCACGACGGAGCTTCCGTTGCCGCGGCCGAGCTTGAAGG
JMFF008N12+ AAGAGGCGGTGGCGGCGGCGGCCACGACGGAGCTTCCGTTGCCGCGGCCGAGCTTGAAGG
                      ____________________________________________________________
consensus AAGAGGCGGTGGCGGCGGCGGCCACGACGGAGCTTCCGTTGCCGCGGCCGAGCTTGAAGG
 
. : . : . : . : . : . :
JMFN008L12+ ACTGCATTTTCTTCAGTACGGATTTGAGCTTCGTGAGCTTTCCACCTTTAGCCATGGCGA
JMFF008N12+ ACTGCATTTTCTTCAGTACGGATTTGAGCTTCGTGAGCTTTCCACCTTTAGCCATGGCGA
                      ____________________________________________________________
consensus ACTGCATTTTCTTCAGTACGGATTTGAGCTTCGTGAGCTTTCCACCTTTAGCCATGGCGA
 
. : . : . : . : . : . :
JMFN008L12+ TCGAACAGAGGAGATGAGAGAAGA
JMFF008N12+ TCGAACAGAGGAGATGAGAGAAGAGAGAGAGAGAGAACAGAGGGGTTTTAGGCTGGGTTC
                      ____________________________________________________________
consensus TCGAACAGAGGAGATGAGAGAAGAGAGAGAGAGAGAACAGAGGGGTTTTAGGCTGGGTTC