Previous Contig 000459:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008N07Sequence536000459 (11)gb:AC002337_15304681e-34Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g688012230 (9)gb:AC002337_15304684e-32Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF010N09Sequence649000459 (11)gb:AC002337_15304682e-55Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g772012230 (9)gb:AC002337_15304689e-43Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF014M03Sequence578000459 (11)gb:AC002337_15304683e-53Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g820012230 (9)gb:AC002337_15304682e-47Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF034C07Sequence331000459 (11)gb:AC002337_15304681e-21Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g758012230 (9)gb:AC002337_15304682e-45Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF041A20Sequence633000459 (11)gb:AC002337_15304682e-52Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g481012230 (9)gb:AC002337_15304688e-15Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF043C04Sequence648000459 (11)gb:AC002337_15304682e-54Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g626012230 (9)gb:AC002337_15304682e-18Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFS069B08Sequence627000459 (11)gb:AC002337_15304681e-67Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFS070H02Sequence625000459 (11)gb:AC002337_15304683e-53Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFS075B01Sequence627000459 (11)gb:AC002337_15304688e-51Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFS101G09Sequence604000459 (11)gb:AC002337_15304684e-50Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMSF009I24Sequence242000459 (11)gb:AC002337_15304683e-17Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g743012230 (9)gb:AC002337_15304682e-41Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS069B08+ AATAACATCCTGTTCACTC
                      ____________________________________________________________
consensus AATAACATCCTGTTCACTC
 
. : . : . : . : . : . :
JMFS069B08+ ATGCCTGAAATAGAGGGATTTTCCTCGTAGAAGTCCTTGTTGAATGGCTCATAATCAATT
JMFF014M03+ TGGCTCATAATCAATT
JMFF010N09+ ATAGAGGGATTTTCCTCGTAGAAGTCCTTGTTGAATGGCTCATAATCAATT
                      ____________________________________________________________
consensus ATGCCTGAAATAGAGGGATTTTCCTCGTAGAAGTCCTTGTTGAATGGCTCATAATCAATT
 
. : . : . : . : . : . :
JMFS069B08+ GAGCTATGATCCAGAGCTGGAATCGGCTCAATCTTTTTCTTGTCAAGAATTATAGGATTA
JMFF014M03+ GAGCTATGATCCAGAGCTGGAATCGGCTCAATCTTTTTCTTGTCAAGAATTATAGGATTA
JMFF010N09+ GAGCTATGATCCAGAGCTGGAATCGGCTCAATCTTTTTCTTGTCAAGAATTATAGGATTA
JMFS101G09+ TCTTGTCAAGAATTATAGGATTA
JMFF041A20+ TCGGCTCAATCTTTNTCTTGTCAAGAATTATAGGATTA
JMFS070H02+ CTGGAATCGGCTCAATCTTTTTCTTGTCAAGAATTATAGGATTA
JMFS075B01+ GAGCTGGAATCGGCTCAATC-TTTTCTTGTCAAGAATTATAGGATTA
JMFF043C04+ CAGAGCTGGAATCGGCTCAATCTTTTTCTTGTCAAGAATTATAGGATTA
                      ____________________________________________________________
consensus GAGCTATGATCCAGAGCTGGAATCGGCTCAATCTTTTTCTTGTCAAGAATTATAGGATTA
 
. : . : . : . : . : . :
JMFS069B08+ TCATCGGAATCATACTCGACGAGCCCTGCGTCCACAGCCTTGGCTGCGGCATAAACCTCC
JMFF014M03+ TCATCGGAATCATACTCGACGAGCCCTGCGTCCACAGCCTTGGCTGCGGCATAAACCTCC
JMFF010N09+ TCATCGGAATCATACTCGACGAGCCCTGCGTCCACAGCCTTGGCTGCGGCATAAACCTCC
JMFS101G09+ TCATCGGAATCATACTCGACGAGCCCTGCGTCCACAGCCTTGGCTGCGGCATAAACCTCC
JMFF041A20+ TCATCGGAATCATACTCGACGAGCCCTGCGTCCACAGCCTTGGCTGCGGCATAAACCTCC
JMFS070H02+ TCATCGGAATCATACTCGACGAGCCCTGCGTCCACAGCCTTGGCTGCGGCATAAACCTCC
JMFS075B01+ TCATCGGAATCATACTCGACGAGCCCTGCGTCCACAGCCTTGGCTGCGGCATAAACCTCC
JMFF043C04+ TCATCGGAATCATACTCGACGAGCCCTGCGTCCACAGCCTTGGCTGCGGCATAAACCTCC
                      ____________________________________________________________
consensus TCATCGGAATCATACTCGACGAGCCCTGCGTCCACAGCCTTGGCTGCGGCATAAACCTCC
 
. : . : . : . : . : . :
JMFS069B08+ TCAT-CCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
JMFF014M03+ TCATCCCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
JMFF010N09+ TCATCCCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
JMFS101G09+ TCAT-CCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
JMFF041A20+ TCAT-CCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
JMFS070H02+ TCAT-CCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
JMFS075B01+ TCAT-CCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
JMFF043C04+ TCAT-CCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
JMFF008N07+ T-CCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
                      ____________________________________________________________
consensus TCAT-CCGAGTTATATCCAGCGTTAAGAGCCTCCGCAGCCAATTGCAACCCTATGTCCTT
 
. : . : . : . : . : . :
JMFS069B08+ CTTCGCTTTCAGAAAACTCTCCATGGGATCATCCTCAATATCATCCTTGTACTTGTCCAA
JMFF014M03+ CTTCGCTTTCAGAAAACTCTCCATGGTATCATCCTCAATATCATCCTTGTACTTGTCCAA
JMFF010N09+ CTTCGCTTTCAGAAAACTCTCCATGGGATCATCCTCAATATCATCCTTGTACTTGTCCAA
JMFS101G09+ CTTCGCTTTCAGAAAACTCTCCATGGGATCATCCTCAATATCATCCTTGTACTTGTCCAA
JMFF041A20+ CTTCGCTTTCAGAAAACTCTCCATGGGATCATCCTCAATATCATCCTTGTACTTGTCCAA
JMFS070H02+ CTTCGCTTTCAGAAAACTCTCCATGGGATCATCCTCAATATCATCCTTGTACTTGTCCAA
JMFS075B01+ CTTCGCTTTCAGAAAACTCTCCATGGGATCATCCTCAATATCATCCTTGTACTTGTCCAA
JMFF043C04+ CTTCGCTTTCAGAAAACTCTCCATGGGATCATCCTCAATATCATCCTTGTACTTGTCCAA
JMFF008N07+ CTTCGCTTTCAGAAAACTCTCCATGGGATCATCCTCAATATCATCCTTGTACTTGTCCAA
                      ____________________________________________________________
consensus CTTCGCTTTCAGAAAACTCTCCATGGGATCATCCTCAATATCATCCTTGTACTTGTCCAA
 
. : . : . : . : . : . :
JMFS069B08+ CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
JMFF014M03+ CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
JMFF010N09+ CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTCCGTGAATCCCCTCCATAAA
JMFS101G09+ CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
JMFF041A20+ CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
JMFS070H02+ CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
JMFS075B01+ CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
JMFF043C04+ CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
JMFF034C07+ TGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
JMFF008N07+ CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
                      ____________________________________________________________
consensus CTTCTCCTTGGGCTTCGGAGGCGGCGCTGCCTTCATCTCTTCGTGAATCCCCTCCATAAA
 
. : . : . : . : . : . :
JMFS069B08+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
JMFF014M03+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
JMFF010N09+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
JMFS101G09+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
JMFF041A20+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
JMFS070H02+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
JMFS075B01+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
JMFF043C04+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTG--ATCGTTAATATCATTATT
JMFF034C07+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
JMFF008N07+ CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
                      ____________________________________________________________
consensus CGCATCCAGAGGGTCGATTTCATCGTCGGCACCACCACTGCCATCGTTAATATCATTATT
 
. : . : . : . : . : . :
JMFS069B08+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMFF014M03+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMFF010N09+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMFS101G09+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMFF041A20+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMFS070H02+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMFS075B01+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMFF043C04+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMFF034C07+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMSF009I24+ GTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
JMFF008N07+ GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
                      ____________________________________________________________
consensus GTTGTCTTCGTTGCCATCTCGTTCATCGTAATCAATATTATCCAAGTCAGTATCTTCGTA
 
. : . : . : . : . : . :
JMFS069B08+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMFF014M03+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMFF010N09+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMFS101G09+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMFF041A20+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMFS070H02+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMFS075B01+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMFF043C04+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMFF034C07+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMSF009I24+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
JMFF008N07+ ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
                      ____________________________________________________________
consensus ATTGTCGTGACCACCGACGGAGCGGGACGAGGGCGGTACGTAGAGACGCTGAGGAGCTTC
 
. : . : . : . : . : . :
JMFS069B08+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMFF014M03+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMFF010N09+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMFS101G09+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMFF041A20+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMFS070H02+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMFS075B01+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMFF043C04+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMFF034C07+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMSF009I24+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
JMFF008N07+ CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
                      ____________________________________________________________
consensus CGCTCGCTCGAAGTTGTATGTTGCCTGTCGATTAATACCAAAGCCATCGAATCCGAACTT
 
. : . : . : . : . : . :
JMFS069B08+ TCTCTTCGA
JMFF014M03+ TCTCTTCGACATAGTT
JMFF010N09+ TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAAT
JMFS101G09+ TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAATAG
JMFF041A20+ TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAATAG
JMFS070H02+ TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAATAG
JMFS075B01+ TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAATAG
JMFF043C04+ TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAATAG
JMFF034C07+ TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAAT
JMSF009I24+ TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAAT
JMFF008N07+ TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAATAG
                      ____________________________________________________________
consensus TCTCTTCGACATAGTTCTGTATTTCGGGTGACCACCGAGAAATCTGAAACCCTAAAATAG
 
. : . : . : . : . : . :
JMFS101G09+ CAATTGGACTGTCTTGTCCGGATAAACCCTAATTACGAATCG
JMFF041A20+ CAATTGGACTGTCTTGTCCGGATAAACCCTAATTACGAATCGCTTGGTACTTCAA
JMFS070H02+ CAATTGGACTGTCTTGTCCGGATAAACCCTAATTACGAATCG
JMFS075B01+ CAATTGGACTGTCTTGTCCGGATAAACCCTAATTACGAATCG
JMFF043C04+ CAATTGGACTGTCTTGTCCGGATAAACCCTAATTACGAATCGCTTGGTACTTCAA
JMFF008N07+ CAATTGGACTGTCTTGTCCGGATAAACCCTAATTACGAATCGCTTGGTACTTCAATCATC
                      ____________________________________________________________
consensus CAATTGGACTGTCTTGTCCGGATAAACCCTAATTACGAATCGCTTGGTACTTCAATCATC