Previous Contig 000451:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008L05Sequence605000451 (7)gb:AF181683_17748612e-41Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.718008570 (11)gb:AK175297_18172854e-53Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF015J14Sequence537000451 (7)gb:AF181683_17748617e-73Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.682008570 (11)gb:AK175297_18172856e-64Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF019D10Sequence565000451 (7)gb:AF181683_17748612e-63Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.709008570 (11)gb:AK175297_18172853e-68Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF019K15Sequence572000451 (7)gb:AF181683_17748615e-64Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.765008570 (11)gb:AK175297_18172851e-75Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF030L20Sequence185000451 (7)gb:AF181683_17748613e-08Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.743008570 (11)gb:AK175297_18172854e-73Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF034D23Sequence437000451 (7)gb:AF181683_17748615e-56Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.553008570 (11)gb:AK175297_18172852e-42Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMSF044N08Sequence727000451 (7)gb:AF181683_17748615e-85Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.721008570 (11)gb:AK175297_18172853e-72Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044N08+ CGCAGCGACCGTTCCGCGTACGTTATTATCGCGCTTGCTAACGTCAACGGCT
                      ____________________________________________________________
consensus CGCAGCGACCGTTCCGCGTACGTTATTATCGCGCTTGCTAACGTCAACGGCT
 
. : . : . : . : . : . :
JMFF015J14+ AGAACGCGACGTCGAGAATCG
JMSF044N08+ TCGCGGTGCGAGACCTCATCGTAGCGATAATTCTGGCGAAGAACGCGACGTCGAGAATCG
                      ____________________________________________________________
consensus TCGCGGTGCGAGACCTCATCGTAGCGATAATTCTGGCGAAGAACGCGACGTCGAGAATCG
 
. : . : . : . : . : . :
JMFF019D10+ CTCCACGCACG
JMFF019K15+ CTCCACGCACG
JMFF015J14+ TTAGCTCCTCCGTCCACCAATTCGGCGGCGACCTGCTCGGAAAATTCGCCTCCACGCACG
JMSF044N08+ TTAGCTCCTCCGTCCACCAATTCGGCGGCGACCTGCTCGGAAAATTCGCCTCCACGCACG
                      ____________________________________________________________
consensus TTAGCTCCTCCGTCCACCAATTCGGCGGCGACCTGCTCGGAAAATTCGCCTCCACGCACG
 
. : . : . : . : . : . :
JMFF019D10+ CCTTTGCACTCGCTAATTCCACGCATCTCTGCACGATTTTCAGATCTTCGGCCAGCGGGA
JMFF019K15+ CCTTTGCACTCGCTAATTCCACGCATCTCTGCACGATTTTCAGATCTTCGGCCAGCGGGA
JMFF015J14+ CCTTTGCACTCGCTAATTCCACGCATCTCTGCACGATTTTCAGATCTTCGGCCAGCGGGA
JMSF044N08+ CCTTTGCACTCGCTAATTCCACGCATCTCTGCACGATTTTCAGATCTTCGGCCAGCGGGA
JMFF008L05+ CGGGA
                      ____________________________________________________________
consensus CCTTTGCACTCGCTAATTCCACGCATCTCTGCACGATTTTCAGATCTTCGGCCAGCGGGA
 
. : . : . : . : . : . :
JMFF034D23+ CCT
JMFF019D10+ GAAGCTCCTCGCAGGATTTAAGCACGACAAGCGCGCCGGAAAGGCTGGACAGGGCCACCT
JMFF019K15+ GAAGCTCCTCGCAGGATTTAAGCACGACAAGCGCGCCGGAAAGGCTGGACAGGGCCACCT
JMFF015J14+ GAAGCTCCTCGCAGGATTTAAGCACGACAAGCGCGCCGGAAAGGCTGGACAGGGCCACCT
JMSF044N08+ GAAGCTCCTCGCAGGATTTAAGCACGACAAGCGCGCCGGAAAGGCTGGACAGGGCCACCT
JMFF008L05+ GAAGCTCCTCGCAGGATTTAAGCACGACAAGCGCGCCGGAAAGGCTGGACAGGGCCACCT
                      ____________________________________________________________
consensus GAAGCTCCTCGCAGGATTTAAGCACGACAAGCGCGCCGGAAAGGCTGGACAGGGCCACCT
 
. : . : . : . : . : . :
JMFF034D23+ GCGACAGAAAATCCTCCGTCCGACCGGCGAGGTTGTTGTCGCAGTACTTGTCCGTCATCT
JMFF019D10+ GCGACAGAAAATCCTCCGTCCGACCGGCGAGGTTGTTGTCGCAGTACTTGTCCGTCATCT
JMFF019K15+ GCGACAGAAAATCCTCCGTCCGACCGGCGAGGTTGTTGTCGCAGTACTTGTCCGTCATCT
JMFF015J14+ GCGACAGAAAATCCTCCGTCCGACCGGCGAGGTTGTTGTCGCAGTACTTGTCCGTCATCT
JMSF044N08+ GCGACAGAAAATCCTCCGTCCGACCGGCGAGGTTGTTGTCGCAGTACTTGTCCGTCATCT
JMFF008L05+ GCGACAGAAAATCCTCCGTCCGACCGGCGAGGTTGTTGTCGCAGTACTTGTCCGTCATCT
                      ____________________________________________________________
consensus GCGACAGAAAATCCTCCGTCCGACCGGCGAGGTTGTTGTCGCAGTACTTGTCCGTCATCT
 
. : . : . : . : . : . :
JMFF034D23+ GAAGATACTCGGCGGCGCAACGCAGAGCCGCCACGTT-ATGTACAGTGATCTCGAAGTTG
JMFF019D10+ GAAGATACTCGGCGGCGCAACGCAGAGCCGCCACGTT-ATGTACAGTGATCTCGAAGTTG
JMFF019K15+ GAAGATACTCGGCGGCGCAACGCAGAGCCGCCACGTT-ATGTACAGTGATCTCGAAGTTG
JMFF015J14+ GAAGATACTCGGCGGCGCAACGCAGAGCCGCCACGTT-ATGTACAGTGATCTCGAAGTTG
JMSF044N08+ GAAGATACTCGGCGGCGCAACGCAGAGCCGCCACGTT-ATGTACAGTGATCTCGAAGTTG
JMFF008L05+ GAAGATACTCGGCGGCGCAACGCAGAGCCGCCACGTTAATGTACAGTGATCTCGAAGTTG
                      ____________________________________________________________
consensus GAAGATACTCGGCGGCGCAACGCAGAGCCGCCACGTT-ATGTACAGTGATCTCGAAGTTG
 
. : . : . : . : . : . :
JMFF034D23+ ACTCCATAGCAGAACTTCGCCG-CCCTTTCGAAGATCTCAGGGCCGCCGGGAATCCCAGA
JMFF019D10+ ACTCCATAGCAGAACTTCGCCG-CCCTTTCGAAGATCTCAGGGCCGCCGGGAATCCCAGA
JMFF019K15+ ACTCCATAGCAGAACTTCGCCG-CCCTTTCGAAGATCTCAGGGCCGCCGGGAATCCCAGA
JMFF015J14+ ACTCCATAGCAGAACTTCGCCG-CCCTTTCGAAGATCTCAGGGCCGCCGGGAATCCCAGA
JMSF044N08+ ACTCCATAGCAGAACTTCGCCG-CCCTTTCGAAGATCTCAGGGCCGCCGGGAATCCCAGA
JMFF008L05+ ACTCCATAGCAGAACTTCGCCGCCCCTTTCGAAGATCTCAGGGCCGCCGGGAATCCCAGA
                      ____________________________________________________________
consensus ACTCCATAGCAGAACTTCGCCG-CCCTTTCGAAGATCTCAGGGCCGCCGGGAATCCCAGA
 
. : . : . : . : . : . :
JMFF034D23+ CAGATTTATCCTCGTTAAATCAGCTTCTTTACTGTCCATAATCAATTTCCTTATATAATT
JMFF019D10+ CAGATTTATCCTCGTTAAATCAGCTTCTTTACTGTCCATAATCAATTTCCTTATATAATT
JMFF019K15+ CAGATTTATCCTCGTTAAATCAGCTTCTTTACTGTCCATAATCAATTTCCTTATATAATT
JMFF015J14+ CAGATTTATCCTCGTTAAATCAGCTTCTTTACTGTCCATAATCAATTTCCTTATATAATT
JMSF044N08+ CAGATTTATCCTCGTTAAATCAGCTTCTTTACTGTCCATAATCAATTTCCTTATATAATT
JMFF008L05+ CAGATTTATCCTCGTTAAATCAGCTTCTTTACTGTCCATAATCAATTTCCTTATATAATT
                      ____________________________________________________________
consensus CAGATTTATCCTCGTTAAATCAGCTTCTTTACTGTCCATAATCAATTTCCTTATATAATT
 
. : . : . : . : . : . :
JMFF034D23+ GCTCTTCGCCACAAGCATAAACTTGTGAAGGGAAAAACTGGCTTCCCCGACTTCAACAAT
JMFF030L20+ CAAGCATAAACTNGTGAAGGGAAAAACTGGCTTCCCCGACTTCAACAAT
JMFF019D10+ GCTCTTCGCCACAAGCATAAACTTGTGAAGGGAAAAACTGGCTTCCCCGACTTCAACAAT
JMFF019K15+ GCTCTTCGCCACAAGCATAAACTTGTGAAGGGAAAAACTGGCTTCCCCGACTTCAACAAT
JMFF015J14+ GCTCTTCGCCACAAGCATAAACTTGTGAAGGGAAAAACTGGCTTCCCCAACTTCAACAAT
JMSF044N08+ GCTCTTCGCCACAAGCATAAACTTGTGAAGGGAAAAACTGGCTTCCCCGACTTCAACAAT
JMFF008L05+ GCTCTTCGCCACAAGCATAAACTTGTGAAGGGAAAAACTGGCTTCCCCGACTCCAACAAT
                      ____________________________________________________________
consensus GCTCTTCGCCACAAGCATAAACTTGTGAAGGGAAAAACTGGCTTCCCCGACTTCAACAAT
 
. : . : . : . : . : . :
JMFF034D23+ AACATCAGTGGGAATTTCTTGAGAGAAAACCCATTGGCCGGTTCTCTCCATGGCAAGCGA
JMFF030L20+ AACATCAGTGGGAATTTNTNGAGAGAAAACCCATTGNCCGGTTCTCTCCANGGCAAGCGA
JMFF019D10+ AACATCAGTGGGAATTTCTTGAGAGAAAACCCATTGGCCGGTTCTCTCCATGGCAAGCGA
JMFF019K15+ AACATCAGTGGGAATTTCTTGAGAGAAAACCCATTGGCCGGTTCTCTCCATGGCAAGCGA
JMFF015J14+ AACATCAGTGGGAATTTCTTGAGAGAAAACCCATTGGC
JMSF044N08+ AACATCAGTGGGAATTTCTTGAGAGAAAACCCATTGGCCGGTTCTCTCCATGGCAAGCGA
JMFF008L05+ AACATCAGTGGGAATTTCTTGAGAGAAAACCCATTGGCCGGTTCTCTCCATGGCAAGCGA
                      ____________________________________________________________
consensus AACATCAGTGGGAATTTCTTGAGAGAAAACCCATTGGCCGGTTCTCTCCATGGCAAGCGA
 
. : . : . : . : . : . :
JMFF034D23+ AAGCCGGGTGGCGGCGGATTTCAGAGGGGAAGCCATATTTGAAGGCTTGAAGCTTTTGGG
JMFF030L20+ AAGCCGGGTGGCGGCGGATTTCAGAGGGGAAGCCATATTTGAAGGCNTGAAGCTTTTGGG
JMFF019D10+ AAGCCGGGTGGCGGCGGATTTCAGAGGGGAAGCCATATTTGAAGGCTTGAAGCTTTTGGG
JMFF019K15+ AAGCCGGGTGGCGGCGGATTTCAGAGGGGAAGCCATATTTGAAGGCTTGAAGCTTTTGGG
JMSF044N08+ AAGCCGGGTGGCGGCGGATTTCAGAGGGGAAGCCATATTTGAAGGCTTGAAGCTTTTGGG
JMFF008L05+ AAGCCGGGTGGCGGCGGATTTCAGAGGGGAAGCCATATTTGAAGGCTTGAAGCTTTTGGG
                      ____________________________________________________________
consensus AAGCCGGGTGGCGGCGGATTTCAGAGGGGAAGCCATATTTGAAGGCTTGAAGCTTTTGGG
 
. : . : . : . : . : . :
JMFF034D23+ AGGGAGAGATTAGGAT
JMFF030L20+ AGGGAGAGATTAGGAT
JMFF019D10+ AGGGAGAGATTAGGAT
JMFF019K15+ AGGGAGAGATTAG
JMSF044N08+ AGGGAGAGATTAGGAT
JMFF008L05+ AGGGAGAGATTAGGATAAGATGCAGAAATCTGGTTTTGGGTTATATAGATAGAGAGATGT
                      ____________________________________________________________
consensus AGGGAGAGATTAGGATAAGATGCAGAAATCTGGTTTTGGGTTATATAGATAGAGAGATGT
 
. : . : . : . : . : . :
JMFF008L05+ AACATTATTTGTCATGGTGTAACTTTTCTTTTTTCCTTTTTTTGGATGAAAAGGAAACCC
                      ____________________________________________________________
consensus AACATTATTTGTCATGGTGTAACTTTTCTTTTTTCCTTTTTTTGGATGAAAAGGAAACCC