Previous Contig 000448:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008K12Sequence493000448 (2)478000448 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008K12+ AGATCAGCTCCAT
JMFF008K12- AGATCAGCTCCAT
                      ____________________________________________________________
consensus AGATCAGCTCCAT
 
. : . : . : . : . : . :
rJMFF008K12+ TCATTTTCTCTCTGCATTCAAAGTTTAATTTGAATTTTCTCCGAACCCGTTTTCCGTTTC
JMFF008K12- TCATTTTCTCTCTGCATTCAAAGTTTAATTTGAATTTTCTCCGAACCCGTTTTCCGTTTC
                      ____________________________________________________________
consensus TCATTTTCTCTCTGCATTCAAAGTTTAATTTGAATTTTCTCCGAACCCGTTTTCCGTTTC
 
. : . : . : . : . : . :
rJMFF008K12+ CGATCATTATACTACCGAGAATGAATTCCATGAGGATGGCTGCACTCCCAATTCTTGGAT
JMFF008K12- CGATCATTATACTACCGAGAATGAATTCCATGAGGATGGCTGCACTCCCAATTCTTGGAT
                      ____________________________________________________________
consensus CGATCATTATACTACCGAGAATGAATTCCATGAGGATGGCTGCACTCCCAATTCTTGGAT
 
. : . : . : . : . : . :
rJMFF008K12+ TCATGTTGATGGCTCTGCTTCAACTCGGGTCGGGTCAAATCACGGCTCCTTCTCCTGCTC
JMFF008K12- TCATGTTGATGGCTCTGCTTCAACTCGGGTCGGGTCAAATCACGGCTCCTTCTCCTGCTC
                      ____________________________________________________________
consensus TCATGTTGATGGCTCTGCTTCAACTCGGGTCGGGTCAAATCACGGCTCCTTCTCCTGCTC
 
. : . : . : . : . : . :
rJMFF008K12+ CGGCCGCCGCCCCTTCCAATGATGGCGTCGCCATTGATCAAGGAATTGCTTACGTTCTTC
JMFF008K12- CGGCCGCCGCCCCTTCCAATGATGGCGTCGCCATTGATCAAGGAATTGCTTACGTTCTTC
                      ____________________________________________________________
consensus CGGCCGCCGCCCCTTCCAATGATGGCGTCGCCATTGATCAAGGAATTGCTTACGTTCTTC
 
. : . : . : . : . : . :
rJMFF008K12+ TGCTGGTTGCGCTGGCGGTTACATATTTAGTCCATTAATTAACAGAGTAGAAGATCAGAG
JMFF008K12- TGCTGGTTGCGCTGGCGGTTACATATTTAGTCCATTAATTAACAGAGTAGAAGATCAGAG
                      ____________________________________________________________
consensus TGCTGGTTGCGCTGGCGGTTACATATTTAGTCCATTAATTAACAGAGTAGAAGATCAGAG
 
. : . : . : . : . : . :
rJMFF008K12+ ATTCTTTTTTAGACATTTTACTAAGCTACCAAATTCTTTATTATTATGTATTTGATTTTC
JMFF008K12- ATTCTTTTTTAGACATTTTACTAAGCTACCAAATTCTTTATTATTATGTATTTGATTTTC
                      ____________________________________________________________
consensus ATTCTTTTTTAGACATTTTACTAAGCTACCAAATTCTTTATTATTATGTATTTGATTTTC
 
. : . : . : . : . : . :
rJMFF008K12+ TCCTACACCTGGAGAATTTCATACTTTTGTATTCTTTCTTGATGGGATTGTAAAGGAGTT
JMFF008K12- TCCTACACCTGGAGAATTTCATACTTTTGTATTCTTTCTTGATGGGATTGTAAAGGAGTT
                      ____________________________________________________________
consensus TCCTACACCTGGAGAATTTCATACTTTTGTATTCTTTCTTGATGGGATTGTAAAGGAGTT
 
. : . : . : . : . : . :
rJMFF008K12+ TTTCTTCGGTTAGTTACTACATATATTATATGTATAATACAAATT
JMFF008K12- TTTCTTCGGTTAGTTACTACATATATTATATGTATAATACAAATTCGTTTACAGTTCANA
                      ____________________________________________________________
consensus TTTCTTCGGTTAGTTACTACATATATTATATGTATAATACAAATTCGTTTACAGTTCANA