Previous Contig 000443:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008H24Sequence575000443 (5)gb:AY338256_16004477e-59Pyrus pyrifolia synptobrevin-related protein mRNA, partial cds.737000443 (5)gb:AP003743_18327424e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMFN001B02Sequence517000443 (5)gb:AY338256_16004475e-56Pyrus pyrifolia synptobrevin-related protein mRNA, partial cds.
JMFN006I04Sequence607000443 (5)gb:AY338256_16004476e-81Pyrus pyrifolia synptobrevin-related protein mRNA, partial cds.
JMFN041A04Sequence643000443 (5)gb:AC108906_17386905e-44Oryza sativa chromosome 3 BAC OSJNBa0087C10 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN041A04+ GAAAATGCAAAACATAT
rJMFF008H24- TAT
                      ____________________________________________________________
consensus GAAAATGCAAAACATAT
 
. : . : . : . : . : . :
JMFN041A04+ CTGTATTCTGTAAACTGAAATGAAAATACCAATATATATCAACTAAAAGACCAAAGGTTC
rJMFF008H24- CTGTATTCTGTAAACTGAAATGAAAATACCAATATATATCAACTAAAAGACCAAAGGTTC
                      ____________________________________________________________
consensus CTGTATTCTGTAAACTGAAATGAAAATACCAATATATATCAACTAAAAGACCAAAGGTTC
 
. : . : . : . : . : . :
JMFN041A04+ CAAAATAAAAGAAAATAAAATCAAATCAAATAAAAGACCAAAGAAAGAAAGAAAGGCATT
rJMFF008H24- CAAAATAAAAGAAAATAAAATCAAATCAAATAAAAGACCAAAGAAAGAAAGAAAGGCATT
                      ____________________________________________________________
consensus CAAAATAAAAGAAAATAAAATCAAATCAAATAAAAGACCAAAGAAAGAAAGAAAGGCATT
 
. : . : . : . : . : . :
JMFN041A04+ TACAGATATACTATAGAAGAATGGTTGCAAATCGATCAAACGGTTCCTATGGCTTCAAAA
rJMFF008H24- TACAGATATACTATAGAAGAATGGTTGCAAATCGATCAAACGGTTCCTATGGCTTCAAAA
                      ____________________________________________________________
consensus TACAGATATACTATAGAAGAATGGTTGCAAATCGATCAAACGGTTCCTATGGCTTCAAAA
 
. : . : . : . : . : . :
JMFN041A04+ CGAAAGATTTCAGTGGTGCATATGCCAACACAAAGTTGAGTGCCTCCGAGTATATCATGG
rJMFF008H24- CGAAAGATTTCAGTGGTGCATATGCCAACACAAAGTTGAGTGCCTCCGAGTATATCATGG
                      ____________________________________________________________
consensus CGAAAGATTTCAGTGGTGCATATGCCAACACAAAGTTGAGTGCCTCCGAGTATATCATGG
 
. : . : . : . : . : . :
JMFN041A04+ CAAAAAAAGGCTCACTTTCCGCAGTTGAACCCGTGGCAAACAGAGAGCACTATGATGAGG
rJMFF008H24- C-AAAAAAGGCTCACTTTCCGCAGTTGAACCCGTGGCAAACAGAGAGCACTATGATGAGG
                      ____________________________________________________________
consensus CAAAAAAAGGCTCACTTTCCGCAGTTGAACCCGTGGCAAACAGAGAGCACTATGATGAGG
 
. : . : . : . : . : . :
JMFN041A04+ ATTAGCGCAATTATAATTCCCAATGCAATCAGCTTAATCTTCATGTTTTGCAGCCACATT
rJMFF008H24- ATTAGCGCAATTATAATTCCCAATACAATCAGCTTAATCTTCATGTTTTGCAGCCACATT
                      ____________________________________________________________
consensus ATTAGCGCAATTATAATTCCCAATGCAATCAGCTTAATCTTCATGTTTTGCAGCCACATT
 
. : . : . : . : . : . :
JMFN041A04+ TTTCTCCGGATTTGTGTGCCAGTGTTTCTGAAGTCCTGTGCCTGATTATGAAGATTCTCT
rJMFF008H24- TTTCTCCGGATTTGTGTGCCAGTGTTTCTGAAGTCCTGTGCCTGATTATGAAGATTCTCT
JMFN006I04+ GCCAGTGTTTCTGAAGTCCTGTGCCTGATTATGAAGATTCTCT
                      ____________________________________________________________
consensus TTTCTCCGGATTTGTGTGCCAGTGTTTCTGAAGTCCTGTGCCTGATTATGAAGATTCTCT
 
. : . : . : . : . : . :
JMFN041A04+ GTCTTATCCACGAGAAGCTCTATCTTTTCCCCACGGTCTAGAACCTTCTCAATATTCTCC
rJMFF008H24- GTCTTATCCACGAGAAGCTCTATCTTTTCCCCACGGTCTAGAACCTTCTCAATATTCTCC
JMFN006I04+ GTCTTATCCACGAGAAGCTCTATCTTTTCCCCACGGTCTAGAACCTTCTCAATATTCTCC
                      ____________________________________________________________
consensus GTCTTATCCACGAGAAGCTCTATCTTTTCCCCACGGTCTAGAACCTTCTCAATATTCTCC
 
. : . : . : . : . : . :
JMFN041A04+ ATCATGACACCTTTGACTTCTGACACCTGAGCTTTCACCTTTGAAAGTTTGCTCACCTCC
rJMFF008H24- ATCATGACACCTTTGACTTCTGACACCTGAGCTTTCACCTTTGAAAGTTTGCTCACCTCC
JMFN006I04+ ATCATGACACCTTTGACTTCTGACACCTGAGCTTTCACCTTTGAAAGTTTGCTCACCTCC
JMFN001B02+ CTTTGAAAGTTTGCTCACCTCC
JMFF008H24+ CCTGAGCTTTCACCTTTGAAAGTTTGCTCACCTCC
                      ____________________________________________________________
consensus ATCATGACACCTTTGACTTCTGACACCTGAGCTTTCACCTTTGAAAGTTTGCTCACCTCC
 
. : . : . : . : . : . :
JMFN041A04+ TCAGGATGGTCAACACAATATTGCATATGGTCCCTTAATTTAGGCCCAAATTCCCTGTTA
rJMFF008H24- TCAGGATGGTCAACACAATATTGCATATGGTCCCTTAATTTAGGCCCAAATTCCCTGTTA
JMFN006I04+ TCAGGATGGTCAACACAATATTGCATATGGTCCCTTAATTTAGGCCCAAATTCCCTGTTA
JMFN001B02+ TCAGGATGGTCAACACAATATTGCATATGGTCCCTTAATTTAGGCCCAAATTCCCTGTTA
JMFF008H24+ TCAGGATGGTCAACACAATATTGCATATGGTCCCTTAATTTAGGCCCAAATTCCCTGTTA
                      ____________________________________________________________
consensus TCAGGATGGTCAACACAATATTGCATATGGTCCCTTAATTTAGGCCCAAATTCCCTGTTA
 
. : . : . : . : . : . :
JMFN041A04+ AGGCTATTAGCAGCAGCAGCTGCTGC
rJMFF008H24- AGGCTATTAGCAGCAGCAGCTGCTGCCTTTCCACCGCCATATTTAGATACAAAGTCATCC
JMFN006I04+ AGGCTATTAGCAGCAGCAGCTGCTGCCTTTCCACCGCCATATTTAGATACAAAGTCATCC
JMFN001B02+ AGGCTATTAGCAGCAGCAGCTGCTGCCTTTCCACCGCCATATTTAGATACAAAGTCATCC
JMFF008H24+ AGGCTATTAGCAGCAGCAGCTGCTGCCTTTCCACCGCCATATTTAGATACAAAGTCATCC
                      ____________________________________________________________
consensus AGGCTATTAGCAGCAGCAGCTGCTGCCTTTCCACCGCCATATTTAGATACAAAGTCATCC
 
. : . : . : . : . : . :
rJMFF008H24- TTGATGCGCTCCAGGTAACCTATGGGGATCTGCCTTCCTGCTGATTCTTCCGCAACCACA
JMFN006I04+ TTGATGCGCTCCAGGTAACCTATGGGGATCTGCCTTCCTGCTGATTCTTCCGCAACCACA
JMFN001B02+ TTGATGCACTCCAGGTAACCTATGGGGATCTGCCTTCCTGCTGATTCTTCCGCAACCACA
JMFF008H24+ TTGATGCGCTCCAGGTAACCTATGGGGATCTGCCTTCCTGCTGATTCTTCCGCAACCACA
                      ____________________________________________________________
consensus TTGATGCGCTCCAGGTAACCTATGGGGATCTGCCTTCCTGCTGATTCTTCCGCAACCACA
 
. : . : . : . : . : . :
rJMFF008H24- CAGTAAGTGAAGCCG
JMFN006I04+ CAGTAAGTGAAGCCGTTATCGACGAGGTAGTTAAAGGTGTGGCCATCGCAGTTGTAGGTG
JMFN001B02+ CAGTAAGTGAAGCCGTTATCGACGAGGTAGTTAAAGGTGTGGCCATCGCAGTTGTAGGTG
JMFF008H24+ CAGTAAGTGAAGCCGTTATCGACGAGGTAGTTAAAGGTGTGGCCATCGCAGTTGTAGGTG
                      ____________________________________________________________
consensus CAGTAAGTGAAGCCGTTATCGACGAGGTAGTTAAAGGTGTGGCCATCGCAGTTGTAGGTG
 
. : . : . : . : . : . :
JMFN006I04+ AACTTGCTGTTGGAGGCAGGAAGCTTCTGCAAGCATTGGTAGGCTATGGAGTTGAAGTTC
JMFN001B02+ AACTTGCTGTTGGAGGCAGGAAGCTTCTGCAAGCATTGGTAGGCTATGGAGTTGAAGTTC
JMFF008H24+ AACTTGCTGTTGGAGGCAGGAAGCTTCTGCAAGCATTGGTAGGCTATGGAGTTGAAGTTC
                      ____________________________________________________________
consensus AACTTGCTGTTGGAGGCAGGAAGCTTCTGCAAGCATTGGTAGGCTATGGAGTTGAAGTTC
 
. : . : . : . : . : . :
JMFN006I04+ CCGCTGAAATCAGTGTGCTCCGCCAGTATCACGGAGCCACGCGCCACGAACGCATAGATC
JMFN001B02+ CCGCTGAAATCAGTGTGCTCCGCCAGTATCACGGAGCCACGCGCCACGAACGCATAGATC
JMFF008H24+ CCGCTGAAATCAGTGTGCTCCGCCAGTATCACGGAGCCACGCGCCACGAACGCATAGATC
                      ____________________________________________________________
consensus CCGCTGAAATCAGTGTGCTCCGCCAGTATCACGGAGCCACGCGCCACGAACGCATAGATC
 
. : . : . : . : . : . :
JMFN006I04+ AGCGCCTTCTG
JMFN001B02+ AGCGCCTTCTG
JMFF008H24+ AGCGCCTTCTGTTGAACCATTTCTCCGATCGGTTTCTGACGGCCGATGCTTTTAGCGTTC
                      ____________________________________________________________
consensus AGCGCCTTCTGTTGAACCATTTCTCCGATCGGTTTCTGACGGCCGATGCTTTTAGCGTTC
 
. : . : . : . : . : . :
JMFF008H24+ TCCGATTATGCTTCGTGATTAAGCAAAAACAAATAGTTGTGGGAAATGAGGTAGCGAACG
                      ____________________________________________________________
consensus TCCGATTATGCTTCGTGATTAAGCAAAAACAAATAGTTGTGGGAAATGAGGTAGCGAACG
 
. : . : . : . : . : . :
JMFF008H24+ CCGAACGGTATAGAAGAAGACCCTTCTCCCCTATCTCTCTCTCTCTCTCTCTCTATATGT
                      ____________________________________________________________
consensus CCGAACGGTATAGAAGAAGACCCTTCTCCCCTATCTCTCTCTCTCTCTCTCTCTATATGT