Previous Contig 000441:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008H18Sequence592000441 (7)pir|T49900|T499003e-382-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido757012144 (7)sp|Q41364|SOT1_SPIOL3e-822-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF014K14Sequence592000441 (7)pir|T49900|T499003e-382-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido668012144 (7)sp|Q41364|SOT1_SPIOL1e-782-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF022M02Sequence491000441 (7)pir|T49900|T499003e-192-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido544012144 (7)sp|Q41364|SOT1_SPIOL1e-522-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF033C03Sequence297000441 (7)606012144 (7)sp|Q41364|SOT1_SPIOL3e-782-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF037J19Sequence534000441 (7)pir|T49900|T499004e-262-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido733012144 (7)sp|Q41364|SOT1_SPIOL6e-792-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMFF047N03Sequence614000441 (7)pir|T49900|T499002e-422-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido602012144 (7)sp|Q41364|SOT1_SPIOL2e-632-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq
JMSF020J10Sequence688000441 (7)pir|T49900|T499002e-512-oxoglutarate/malate translocator-like protein T24H18.30 [similarity] - Arabido757012144 (7)sp|Q41364|SOT1_SPIOL1e-782-oxoglutarate/malate translocator, chloroplast precursor.>gb:A47930_1449453 Seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF020J10+ AATCGCCG
                      ____________________________________________________________
consensus AATCGCCG
 
. : . : . : . : . : . :
JMSF020J10+ GCGCTAACAGAGCCTCGCTGAATACCAAACTGTAGCCGAGCCCCAGGGAGGAGCTGCCGA
                      ____________________________________________________________
consensus GCGCTAACAGAGCCTCGCTGAATACCAAACTGTAGCCGAGCCCCAGGGAGGAGCTGCCGA
 
. : . : . : . : . : . :
JMSF020J10+ AGAGCGAGACGAACTGGTAGGCGATTCTGTTGCCCAGCCCGGTCTTGATAAACCCCCGGG
JMFF047N03+ G
                      ____________________________________________________________
consensus AGAGCGAGACGAACTGGTAGGCGATTCTGTTGCCCAGCCCGGTCTTGATAAACCCCCGGG
 
. : . : . : . : . : . :
JMSF020J10+ CGAAGAAGAACGCGAGCGCGATTAGCCAGGGGATGGGGTCGCCGAACGCGGAAAACGCGG
JMFF047N03+ CGAAGAAGAACGCGAGCGCGATTAGCCAGGGGATGGGGTCGCCGAACGCGGAAAACGCGG
JMFF014K14+ GAACGCGAGCGCGATTAGCCAGGGGATGGGGTCGCCGAACGCGGAAAACGCGG
JMFF008H18+ GAACGCGAGCGCGATTAGCCAGGGGATGGGGTCGCCGAACGCGGAAAACGCGG
                      ____________________________________________________________
consensus CGAAGAAGAACGCGAGCGCGATTAGCCAGGGGATGGGGTCGCCGAACGCGGAAAACGCGG
 
. : . : . : . : . : . :
JMSF020J10+ CGGCGAACGTGAGAGTTTTTGTCAGCACGCACGCGCCGAGGCCCATCAACGCGACGGCGC
JMFF047N03+ CGGCGAACGTGAGAGTTTTTGTCAGCACGCACGCGCCGAGGCCCATCAACGCGACGGCGC
JMFF014K14+ CGGCGAACGTGAGAGTTTTTGTCAGCACGCACGCGCCGAGGCCCATCAACGCGACGGCGC
JMFF037J19+ AACGTGAGAGTTTTTGTCAGCACGCACGCGCCGAGGCCCATCAACGCGACGGCGC
JMFF022M02+ ACGCGACGGCGC
JMFF008H18+ CGGCGAACGTGAGAGTTTTTGTCAGCACGCACGCGCCGAGGCCCATCAACGCGACGGCGC
                      ____________________________________________________________
consensus CGGCGAACGTGAGAGTTTTTGTCAGCACGCACGCGCCGAGGCCCATCAACGCGACGGCGC
 
. : . : . : . : . : . :
JMSF020J10+ CGAGCGGCAGCGGCTGGGTGATGATTCCCACGATGGTGGCCAGGAAAATCGACAGCAACT
JMFF047N03+ CGAGCGGCAGCGGCTGGGTGATGATTCCCACGATGGTGGCCAGGAAAATCGACAGCAACT
JMFF014K14+ CGAGCGGCAGCGGCTGGGTGATGATTCCCACGATGGTGGCCAGGAAAATCGACAGCAACT
JMFF037J19+ CGAGCGGCAGCGGCTGGGTGATGATTCCCACGATGGTGGCCAGGAAAATCGACAGCAACT
JMFF022M02+ CGAGCGGCAGCGGCTGGGTGATGATTCCCACGATGGTGGCCAGGAAAATCGACAGCAACT
JMFF008H18+ CGAGCGGCAGCGGCTGGGTGATGATTCCCACGATGGTGGCCAGGAAAATCGACAGCAACT
                      ____________________________________________________________
consensus CGAGCGGCAGCGGCTGGGTGATGATTCCCACGATGGTGGCCAGGAAAATCGACAGCAACT
 
. : . : . : . : . : . :
JMSF020J10+ GCCACGCGTTCCGGGAAACCCCGCCGGGCTGCGGGACGAACCAGAGAATCACCCCCGTCG
JMFF047N03+ GCCACGCGTTCCGGGAAACCCCGCCGGGCTGCGGGACGAACCAGAGAATCACCCCCGTCG
JMFF014K14+ GCCACGCGTTCCGGGAAACCCCGCCGGGCTGCGGGACGAACCAGAGAATCACCCCCGTCG
JMFF037J19+ GCCACGCGTTCCGGGAAACCCCGCCGGGCTGCGGGACGAACCAGAGAATCACCCCCGTCG
JMFF022M02+ GCCACGCGTTCCGGGAAACCCCGCCGGGCTGCGGGACGAACCAGAGAATCACCCCCGTCG
JMFF008H18+ GCCACGCGTTCCGGGAAACCCCGCCGGGCTGCGGGACGAACCAGAGAATCACCCCCGTCG
                      ____________________________________________________________
consensus GCCACGCGTTCCGGGAAACCCCGCCGGGCTGCGGGACGAACCAGAGAATCACCCCCGTCG
 
. : . : . : . : . : . :
JMSF020J10+ CGATGGACGCCAGAAGCGGCTTAATCGCAGCGCCTTGCCACGGCTGAGCCGGCGCGGCGC
JMFF047N03+ CGATGGACGCCAGAAGCGGCTTAATCGCAGCGCCTTGCCACGGCTGAGCCGGCGCGGCGC
JMFF033C03+ GGCGCGGCGC
JMFF014K14+ CGATGGACGCCAGAAGCGGCTTAATCGCAGCGCCTTGCCACGGCTGAGCCGGCGCGGCGC
JMFF037J19+ CGATGGACGCCAGAAGCGGCTTAATCGCAGCGCCTTGCCACGGCTGAGCCGGCGCGGCGC
JMFF022M02+ CGATGGACGCCAGAAGCGGCTTAATCGCAGCGCCTTGCCACGGCTGAGCCGGCGCGGCGC
JMFF008H18+ CGATGGACGCCAGAAGCGGCTTAATCGCAGCGCCTTGCCACGGCTGAGCCGGCGCGGCGC
                      ____________________________________________________________
consensus CGATGGACGCCAGAAGCGGCTTAATCGCAGCGCCTTGCCACGGCTGAGCCGGCGCGGCGC
 
. : . : . : . : . : . :
JMSF020J10+ CACCGGCGGCGGGGGCCGTGGAAGCTCCGGAAGCTGAGGCCTTTACTATATGATGCAACC
JMFF047N03+ CACCGGCGGCGGGGGCCGTGGAAGCTCCGGAAGCTGAGGCCTTTACTATATGATGCAACC
JMFF033C03+ CACCGGCGGCGGGGGCCGTGGAAGCTCCGGAAGCTGAGGCCTTTACTATATGATGCAACC
JMFF014K14+ CACCGGCGGCGGGGGCCGTGGAAGCTCCGGAAGCTGAGGCCTTTACTATATGATGCAACC
JMFF037J19+ CACCGGCGGCGGGGGCCGTGGAAGCTCCGGAAGCTGAGGCCTTTACTATATGATGCAACC
JMFF022M02+ CACCGGCGGCGGGGGCCGTGGAAGCTCCGGAAGCTGAGGCCTTTACTATATGATGCAACC
JMFF008H18+ CACCGGCGGCGGGGGCCGTGGAAGCTCCGGAAGCTGAGGCCTTTACTATATGATGCAACC
                      ____________________________________________________________
consensus CACCGGCGGCGGGGGCCGTGGAAGCTCCGGAAGCTGAGGCCTTTACTATATGATGCAACC
 
. : . : . : . : . : . :
JMSF020J10+ GCTTCACATTGTTTCTTTCATGGTTCTTGAGCCCGGGAGTAATAAGGAGCTCGGTTTTCG
JMFF047N03+ GCTTCACATTGTTTCTTTCATGGTTCTTGAGCCCGGGAGTAATAAGGAGCTCGGTTTTCG
JMFF033C03+ GCTTCACATTGTTTCTTTCATGGTTCTTGAGCCCGGGAGTAATAAGGAGCTCGGTTTTNG
JMFF014K14+ GCTTCACATTGTTTCTTTCATGGTTCTTGAGCCCGGGAGTAATAAGGAGCTCGGTTTTCG
JMFF037J19+ GCTTCACATTGTTTCTTTCATGGTTCTTGAG-CCGGGAGTAATAAGGAGCTCGGTTTTCG
JMFF022M02+ GCTTCACATTGTTTCTTTCATGGTTCTTGAG-CCGGGAGTAATAAGGAGCTCGGTTTTCG
JMFF008H18+ GCTTCACATTGTTTCTTTCATGGTTCTTGAG-CCGGGAGTAATAAGGAGCTCGGTTTTCG
                      ____________________________________________________________
consensus GCTTCACATTGTTTCTTTCATGGTTCTTGAGCCCGGGAGTAATAAGGAGCTCGGTTTTCG
 
. : . : . : . : . : . :
JMSF020J10+ CAGATTTAAGGTTGAATTGGAGGGGGCGATGGAAGGAGAGACGGTGTGGCCGGAAACGGG
JMFF047N03+ CAGATTTAAGGTTGAATTGGAGGGGGCGATGGAAGGAGAGACGGTGTGGCCGGAAACGGG
JMFF033C03+ CAGATTTAAGGTTGAATTGGAGGGGGCGATGGAAGGAGAGACGGTGTGGCCGGAAACGGG
JMFF014K14+ CAGATTTAAGGTTGAATTGGAGGGGGCGATGGAAGGAGAGACGGTGTGGCCGGAAACGGG
JMFF037J19+ CAGATTTAAGGTTGAATTGGAGGGGGCGATGGAAGGAGAGACGGTGTGGCCGGAAACGGG
JMFF022M02+ CAGATTTAAGGTTGAATTGGAGGGGGCGATGGAAGGAGAGACGGTGTGGCCGGAAACGGG
JMFF008H18+ CAGATTTAAGGTTGAATTGGAGGGGGCGATGGAAGGAGAGACGGTGTGGCCGGAAACGGG
                      ____________________________________________________________
consensus CAGATTTAAGGTTGAATTGGAGGGGGCGATGGAAGGAGAGACGGTGTGGCCGGAAACGGG
 
. : . : . : . : . : . :
JMSF020J10+ GGTTCACGGCGGAGGTGACGGCCAAAGACGCCATCACGGCGATGGCAGTCCGGGGGAGTG
JMFF047N03+ GGTTCACGGCGGAGGTGACGGCCAAAGACGCCATCACGGCGATGGCAGTCCGGGGGAGTG
JMFF033C03+ GGTTCACGGCGGAGGTGACGGCCAAAGACGCCATCACGGCGATGGCAGTCCGGGGGAGTG
JMFF014K14+ GGTTCACGGCGGAGGTGACGGCCAAAGACGCCATCACGGCGATGGCAGTCCGGGGGAGTG
JMFF037J19+ GGTTCACGGCGGAGGTGACGGCCAAAGACGCCATCACGGCGATGGCAGTCCGGGGGAGTG
JMFF022M02+ GGTTCACGGCGGAGGTGACGGCCAAAGACGCCATCACGGCGATGGCAGTCCGGGGGAGTG
JMFF008H18+ GGTTCACGGCGGAGGTGACGGCCAAAGACGCCATCACGGCGATGGCAGTCCGGGGGAGTG
                      ____________________________________________________________
consensus GGTTCACGGCGGAGGTGACGGCCAAAGACGCCATCACGGCGATGGCAGTCCGGGGGAGTG
 
. : . : . : . : . : . :
JMSF020J10+ GAGGTGAGTGGCTAAGGAC
JMFF047N03+ GAGGTGAGTGGCTAAGGACAGAGCAATCTTAGTGAGTGATAGAGACTGATTCAAATGAT
JMFF033C03+ GAGGTGAGTGGCTAAGGACAGAGCAATCCTAGTGAGTGATAGAGA
JMFF014K14+ GAGGTGAGTGGCTAAGGACAGAGCAATCCTAGTGAGTGATAGAGACTGATTCAAATGAT
JMFF037J19+ GAGGTGAGTGGCTAAGGACAGAGCAATCCTAGTGAGTGATAGAGACTGATTCAAATGAT
JMFF022M02+ GAGGTGAGTGGCTAAGGACAGAGCAATCCTAGTGAGTGATAGAGACTGATTCAAATGAT
JMFF008H18+ GAGGTGAGTGGCTAAGGACAGAGCAATCCTAGTGAGTGATAGAGACTGATTCAAATGATT
                      ____________________________________________________________
consensus GAGGTGAGTGGCTAAGGACAGAGCAATCCTAGTGAGTGATAGAGACTGATTCAAATGATT