Previous Contig 000438:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005P17Sequence438000438 (6)pir|T03029|T030295e-45omega-3 fatty acid desaturase (EC 1.14.99.-) FAD7 - common tobacco>gb:AB049577_1740008406 (4)sp|P48620|FD3C_SESIN3e-84Omega-3 fatty acid desaturase, chloroplast precursor (EC 1.14.19.-).>gb:SIU25817
JMFF008G24Sequence459000438 (6)pir|T03029|T030297e-16omega-3 fatty acid desaturase (EC 1.14.99.-) FAD7 - common tobacco>gb:AB049577_1735008406 (4)sp|P48620|FD3C_SESIN1e-85Omega-3 fatty acid desaturase, chloroplast precursor (EC 1.14.19.-).>gb:SIU25817
JMFF028O15Sequence465000438 (6)pir|T03029|T030292e-40omega-3 fatty acid desaturase (EC 1.14.99.-) FAD7 - common tobacco>gb:AB049577_1
JMFS144D04Sequence619000438 (6)pir|T03029|T030295e-70omega-3 fatty acid desaturase (EC 1.14.99.-) FAD7 - common tobacco>gb:AB049577_1
JMSF002C09Sequence274000438 (6)758008406 (4)sp|P48620|FD3C_SESIN1e-94Omega-3 fatty acid desaturase, chloroplast precursor (EC 1.14.19.-).>gb:SIU25817
JMSF034I21Sequence667000438 (6)pir|T03029|T030294e-78omega-3 fatty acid desaturase (EC 1.14.99.-) FAD7 - common tobacco>gb:AB049577_1641008406 (4)sp|P48619|FD3C_RICCO2e-79Omega-3 fatty acid desaturase, chloroplast precursor (EC 1.14.19.-).>pir|T10063|

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS144D04+ GCCAGCAACACTAT
JMSF034I21+ ATCCATGGTAAGGGACAAGAATTGAAGAATGGAGGAGATGGCCAGCAACACTAT
                      ____________________________________________________________
consensus ATCCATGGTAAGGGACAAGAATTGAAGAATGGAGGAGATGGCCAGCAACACTAT
 
. : . : . : . : . : . :
JMFS144D04+ TCAGCTTTGGGTCATTAGAAAAGCTTCCATGGCCACAGTCATGGCCAAGAACAAAGAGAG
JMSF034I21+ TCAGCTTTGGGTCATTAGAAAAGCTTCCATGGCCACAGTCATGGCCAAGAACAAAGAGAG
                      ____________________________________________________________
consensus TCAGCTTTGGGTCATTAGAAAAGCTTCCATGGCCACAGTCATGGCCAAGAACAAAGAGAG
 
. : . : . : . : . : . :
JMFF005P17+ TATTAAGAG
JMFS144D04+ CCCAGAACATGGTTCCTTGAGCCAACCAATACAGAGGCCAAACAATCCAGTTATTAAGAG
JMSF034I21+ CCCAGAACATGGTTCCTTGAGCCAACCAATACAGAGGCCAAACAATCCAGTTATTAAGAG
                      ____________________________________________________________
consensus CCCAGAACATGGTTCCTTGAGCCAACCAATACAGAGGCCAAACAATCCAGTTATTAAGAG
 
. : . : . : . : . : . :
JMFF005P17+ AAGCAGCCATAGCTGCCAATCCAAACACAATTGCAACATCCCTAACCACAAAGCTCATGG
JMFS144D04+ AAGCAGCCATAGCTGCCAATCCAAACACAATTGCAACATCCCTAACCACAAAGCTCATGG
JMFF028O15+ CAATTGCAACATCCCTAACCACAAAGCTCATGG
JMSF034I21+ AAGCAGCCATAGCTGCCAATCCAAACACAATTGCAACATCCCTAACCACAAAGCTCATGG
                      ____________________________________________________________
consensus AAGCAGCCATAGCTGCCAATCCAAACACAATTGCAACATCCCTAACCACAAAGCTCATGG
 
. : . : . : . : . : . :
JMFF005P17+ ACTTCCAAGGGTTCTTCACCCAGCAATGCTTAGGAATGGCTGCTTTGATATCAGACAGCT
JMFS144D04+ ACTTCCAAGGGTTCTTCACCCAGCAATGCTTAGGAATGGCTGCTTTGATATCAGACAGCT
JMFF028O15+ ACTTCCAAGGGTTCTTCACCCAGCAATGCTTAGGAATGGCTGCTTTGATATCAGACAGCT
JMSF034I21+ ACTTCCAAGGGTTCTTCACCCAGCAATGCTTAGGAATGGCTGCTTTGATATCAGACAGCT
                      ____________________________________________________________
consensus ACTTCCAAGGGTTCTTCACCCAGCAATGCTTAGGAATGGCTGCTTTGATATCAGACAGCT
 
. : . : . : . : . : . :
JMFF005P17+ TAAATGGCGGCGGTGCTCCAGGGTCAAAAAACTCAACCCCACCCCCATTGACGCTATTGA
JMFS144D04+ TAAATGGCGGCGGTGCTCCAGGGTCAAAAAACTCAACCCCACCCCCATTGACGCTATTGA
JMFF028O15+ TAAATGGCGGCGGTGCTCCAGGGTCAAAAAACTCAACCCCACCCCCATTGACGCTATTGA
JMSF034I21+ TAAATGGCGGCGGTGCTCCAGGGTCAAAAAACTCAACCCCACCCCCATTGACGCTATTGA
                      ____________________________________________________________
consensus TAAATGGCGGCGGTGCTCCAGGGTCAAAAAACTCAACCCCACCCCCATTGACGCTATTGA
 
. : . : . : . : . : . :
JMFF005P17+ TTCTCTCCCTCTCTTCTTCCTCTTCCTCCCCAACTGAGGGGACCCTCACCGGGGCACTCA
JMFS144D04+ TTCTCTCCCTCTCTTCTTCCTCTTCCTCCCCAACTGAGGGGACCCTCACCGGGGCACTCA
JMFF028O15+ TTCTCTCCCTCTCTTCTTCCTCTTCCTCCCCAACTGAGGGGACCCTCACCGGGGCACTCA
JMSF034I21+ TTCTCTCCCTCTCTTCTTCCTCTTCCTCCCCAACTGAGGGGACCCTCACCGGGGCACTCA
JMFF008G24+ CTTCCTCCCCAACTGAGGGGACCCTCACCGGGGCACTCA
                      ____________________________________________________________
consensus TTCTCTCCCTCTCTTCTTCCTCTTCCTCCCCAACTGAGGGGACCCTCACCGGGGCACTCA
 
. : . : . : . : . : . :
JMFF005P17+ CCCTCAATGCCCAGCTCCTCTCTCTAATCCCAATCAACGAACAAGAACCCAGATCTGTTC
JMFS144D04+ CCCTCAATGCCCAGCTCCTCTCTCTAATCCCAATCAACGAACAAGAACCCAGATCTGTTC
JMFF028O15+ CCCTCAATGCCCAGCTCCTCTCTCTAATCCCAATCAACGAACAAGAACCCAGATCTGTTC
JMSF034I21+ CCCTCAATGCCCAGCTCCTCTCTCTAATCCCAATCAACGAACAAGAACCCAGATCTGTTC
JMFF008G24+ CCCTCAATGCCCAGCTCCTCTCTNTAATCCCAATCAACGAACAAGAACCCAGATCTGTTC
                      ____________________________________________________________
consensus CCCTCAATGCCCAGCTCCTCTCTCTAATCCCAATCAACGAACAAGAACCCAGATCTGTTC
 
. : . : . : . : . : . :
JMFF005P17+ CTGAAACTGTCACCCTTGAGGGGCTGCCACAACTGAGAGAACCCATCCCAGTTCTTGGCT
JMFS144D04+ CTGAAACTGTCACCCTTGAGGGGCTGCCACAACTGAGAGAACCCATCCCAGTTCTTGGCT
JMFF028O15+ CTGAAACTGTCACCCTTGAGGGGCTGCCACAACTGAGAGAACCCATCCCAGTTCTTGGCT
JMSF034I21+ CTGAAACTGTCACCCTTGAGGGGCTGCCACAACTGAGAGAACCCATCCCAGTTCTTGGCT
JMFF008G24+ CTGAAACTGTCACCCTTGAGGGGCTGCCACAACTGAGAGAACCCATCCCAGTTCTTGGCT
                      ____________________________________________________________
consensus CTGAAACTGTCACCCTTGAGGGGCTGCCACAACTGAGAGAACCCATCCCAGTTCTTGGCT
 
. : . : . : . : . : . :
JMFF005P17+ TAGGGTAGATTTTGGGGAATGGTCGGAGACCACATTCTGATAACACCCAACTCGCCATTA
JMFS144D04+ TAGGGTAGATTTTGGGGAATGGTCGGAGACCACATTCTGATAACACCCAACTCGCCATTA
JMFF028O15+ TAGGGTAGATTTTGGGGAATGGTCGGAGACCACATTCTGATAACACCCAACTCGCCATTA
JMSF034I21+ TAGGGTAGATTTTGGGGAATGGTCGGAGACCACATTCTGATAACACCCAACTCGCCATTA
JMSF002C09+ CGGAGACCACATTCTGATAACACCCAACTCGCCATTA
JMFF008G24+ TAGGGTAGATTTTGGGGAATGGTCGGAGACCACATTCTGATAACACCCAACTCGCCATTA
                      ____________________________________________________________
consensus TAGGGTAGATTTTGGGGAATGGTCGGAGACCACATTCTGATAACACCCAACTCGCCATTA
 
. : . : . : . : . : . :
JMFF005P17+ GAGGACGTT
JMFS144D04+ GAGGACGTTAGGGACAGAAAGGTAGAACCTTTGAACTCTGGGCCTCTTCCAATTCAAGAG
JMFF028O15+ GAGGACGTTAGGGACAGAAAGGTAGAACCTTTGAACTCTGGGCCTCTTCCAATTCAAGAG
JMSF034I21+ GAGGACGTTAGGGACAGAAAGGTAGAACCTTTGAACTCTGGGCCTCTTCCAATTCAAGAG
JMSF002C09+ GAGGACGTTAGGGACAGAAAGGTAGAACCTTTGAACTCTGGGCCTCTTCCAATTCAAGAG
JMFF008G24+ GAGGACGTTAGGGACAGAAAGGTAGAACCTTTGAACTCTGGGCCTCTTCCAATTCAAGAG
                      ____________________________________________________________
consensus GAGGACGTTAGGGACAGAAAGGTAGAACCTTTGAACTCTGGGCCTCTTCCAATTCAAGAG
 
. : . : . : . : . : . :
JMFS144D04+ AGAAA
JMFF028O15+ AGAAACAGAATT
JMSF034I21+ AGAAACAGAATT
JMSF002C09+ AGAAACAGAATTGTGGCCTCAAAGACCACACAACAGGATATGTAAGTATTGAAGCCGAAA
JMFF008G24+ AGAAACAGAATTGTGGCCTCAAAGACCACACAACAGGATATGTAAGTATTGAAGCCGAAA
                      ____________________________________________________________
consensus AGAAACAGAATTGTGGCCTCAAAGACCACACAACAGGATATGTAAGTATTGAAGCCGAAA
 
. : . : . : . : . : . :
JMSF002C09+ TCTTGACCAATCAAGAATGGGCTTGTGGTGGGGTTAAGAGGAAGGAGGATGAGGAGATAA
JMFF008G24+ TCTTGACCAATCAAGAATGGGCTTGTGGTGGGGTTAAGAGGAAGGAGGATGAGGAGATAA
                      ____________________________________________________________
consensus TCTTGACCAATCAAGAATGGGCTTGTGGTGGGGTTAAGAGGAAGGAGGATGAGGAGATAA
 
. : . : . : . : . : . :
JMSF002C09+ CACTAGGGAAAGGGATTCTCTCCTTCAATTGCAGCGTCAGAAACCCCAACTTGTG
JMFF008G24+ CACTAGGGAAAGGGATTCTCTCCTTCAATTGCAGCGTCAGAAACCCCAACTTGTGTGGTT
                      ____________________________________________________________
consensus CACTAGGGAAAGGGATTCTCTCCTTCAATTGCAGCGTCAGAAACCCCAACTTGTGTGGTT