Previous Contig 000433:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008G09Sequence458000433 (4)gb:AY280662_15946552e-30Fragaria x ananassa polygalacturonase-like protein mRNA, complete cds.450009206 (4)gb:AY280662_15946555e-43Fragaria x ananassa polygalacturonase-like protein mRNA, complete cds.
JMFF021E18Sequence515000433 (4)gb:AY280662_15946554e-41Fragaria x ananassa polygalacturonase-like protein mRNA, complete cds.668009206 (4)gb:AY280662_15946556e-80Fragaria x ananassa polygalacturonase-like protein mRNA, complete cds.
JMSF023L09Sequence665000433 (4)pir|T47941|T479419e-33hypothetical protein F2A19.90 - Arabidopsis thaliana>gb:ATF2A19_1550424 Arabidop800009206 (4)gb:AY280662_1594655e-107Fragaria x ananassa polygalacturonase-like protein mRNA, complete cds.
JMSF036J24Sequence624000433 (4)gb:AY280662_15946557e-63Fragaria x ananassa polygalacturonase-like protein mRNA, complete cds.649009206 (4)gb:AY280662_15946553e-81Fragaria x ananassa polygalacturonase-like protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023L09+ CTTCCATGACCATA
                      ____________________________________________________________
consensus CTTCCATGACCATA
 
. : . : . : . : . : . :
JMSF023L09+ TGATGGTAATGGCTCCACCACTTCCCAACTGCTTATTTCCTGAAATCAAAACTATACATT
                      ____________________________________________________________
consensus TGATGGTAATGGCTCCACCACTTCCCAACTGCTTATTTCCTGAAATCAAAACTATACATT
 
. : . : . : . : . : . :
JMSF023L09+ ATCCCATTTATGATAATATTTATTTAGCCGGGAAAAGTCTACAATATTGATCGATACTAA
                      ____________________________________________________________
consensus ATCCCATTTATGATAATATTTATTTAGCCGGGAAAAGTCTACAATATTGATCGATACTAA
 
. : . : . : . : . : . :
JMSF023L09+ TACTTTTTGCACCACGTACAAACATGTATTTTTTATACTGGTACCCGATGCAAAAGGTAC
                      ____________________________________________________________
consensus TACTTTTTGCACCACGTACAAACATGTATTTTTTATACTGGTACCCGATGCAAAAGGTAC
 
. : . : . : . : . : . :
JMSF036J24+ CCTGAGAAGCAAGAAGAACAGCATCTT
JMSF023L09+ CAACTTTGATGCAAGTAATATGTGTTTATAGTACCTGAGAAGCAAGAAGAACAGCATCTT
JMFF021E18+ CCTGAGAAGCAAGAAGAACAGCATCTT
JMFF008G09+ CCTGAGAAGCAAGAAGANCAGCATCTT
                      ____________________________________________________________
consensus CAACTTTGATGCAAGTAATATGTGTTTATAGTACCTGAGAAGCAAGAAGAACAGCATCTT
 
. : . : . : . : . : . :
JMSF036J24+ TGTCAAGAAAAAGAGTGAAATGGCTGGTGAGATTGAAAGATCCAGTCAACCAGCGACCAG
JMSF023L09+ TGTCAAGAAAAAGAGTGAAATGGCTGGTGAGATTGAAAGATCCAGTCAACCAGCGACCAG
JMFF021E18+ TGTCAAGAAAAAGAGTGAAATGGCTGGTGAGATTGAAAGATCCAGTCAACCAGCGACCAG
JMFF008G09+ TGTCAAGAAAAAGAGTGAAATGGCTGGTGAGATTGAAAGATCCAGTCAACCAGCGACCAG
                      ____________________________________________________________
consensus TGTCAAGAAAAAGAGTGAAATGGCTGGTGAGATTGAAAGATCCAGTCAACCAGCGACCAG
 
. : . : . : . : . : . :
JMSF036J24+ CGGGGACAAAGAGCTGAGCACCACCCTGCTCTGCATACTGGCTCAACTCATTCACAGCGT
JMSF023L09+ CGGGGACAAAGAGCTGAGCACCACCCTGCTCTGCATACTGGCTCAACTCATTCACAGCGT
JMFF021E18+ CGGGGACAAAGAGCTGAGCACCACCCTGCTCTGCATACTGGCTCAACTCATTCACAGCGT
JMFF008G09+ CGGGGACAAAGAGNTGAGCACCACCCTGCTNTGCATACNGGCTCAACTCATTCACAGCGT
                      ____________________________________________________________
consensus CGGGGACAAAGAGCTGAGCACCACCCTGCTCTGCATACTGGCTCAACTCATTCACAGCGT
 
. : . : . : . : . : . :
JMSF036J24+ TCTGAAACGCTTTTGTGTTGAGTGTTTTGCCATCCCCAACCCCTCCAAAATCTTTAATGG
JMSF023L09+ TCTGAAACGCTTTTGTGTTGAGTGTTTTGCCATCCCCAACCCCTCCAAAATCTTTAATGG
JMFF021E18+ TCTGAAACGCTTTTGTGTTGAGTGTTTTGCCATCCCCAACCCCTCCAAAATCTTTAATGG
JMFF008G09+ TCTGAAACGCTTTTGTGNNGAGTGTTTTGCCATCCCCAACCCCTCCAAAATCTTTAATGG
                      ____________________________________________________________
consensus TCTGAAACGCTTTTGTGTTGAGTGTTTTGCCATCCCCAACCCCTCCAAAATCTTTAATGG
 
. : . : . : . : . : . :
JMSF036J24+ ATGCAGAATGAGCCCTGCAGTTTATAGCTGAATACTCCAACTCATAAAAATTACTATTGC
JMSF023L09+ ATGCAGAATGAGCCCTGCAGTTTATAGCTGAATACTCCAACTCATAAAAATTACTATTGC
JMFF021E18+ ATGCAGAATGAGCCCTGCAGTTTATAGCTGAATACTCCAACTCATAAAAATTACTATTGC
JMFF008G09+ ATGCAGAATGAGCCCTGCAGTTTATAGNTGAATACTCCAACTCATAAAAATTACTATNGC
                      ____________________________________________________________
consensus ATGCAGAATGAGCCCTGCAGTTTATAGCTGAATACTCCAACTCATAAAAATTACTATTGC
 
. : . : . : . : . : . :
JMSF036J24+ TGTTTTCATCTTCAACAACTCCTCCCTTAAACCTTATCCCCTCAACCCATCCTGGACTGC
JMSF023L09+ TGTTTTCATCTTCAACAACTCCTCCCTTAAACCTTATCCCCTCAACCCATCCTGGACTGC
JMFF021E18+ TGTTTTCATCTTCAACAACTCCTCCCTTAAACCTTATCCCCTCAACCCATCCTGGACTGC
JMFF008G09+ TGTTTTCATCTTCAACAACTCCTCCCTTAAACCTTATCCCCTCAACCCATCCTGGACTGC
                      ____________________________________________________________
consensus TGTTTTCATCTTCAACAACTCCTCCCTTAAACCTTATCCCCTCAACCCATCCTGGACTGC
 
. : . : . : . : . : . :
JMSF036J24+ TTAAAGCCATCCCCAATAACACTACCACTAATGTCTTCAACATTTGGAATCTTGATGGCA
JMSF023L09+ TTAAAGCCATCCCCAATAACACTACCACTAATGTCTTCAACATTTGGAATCTTGATGGCA
JMFF021E18+ TTAAGGCCATCCCCAATAACACTACCACTAATGTCTTCAACATTTGGAATCTTGATGGCA
JMFF008G09+ TTAAGGCCATCCCCAATAACACTACCACTAATGTCTTCAACATTTGGAATCTTGATGGCA
                      ____________________________________________________________
consensus TTAAGGCCATCCCCAATAACACTACCACTAATGTCTTCAACATTTGGAATCTTGATGGCA
 
. : . : . : . : . : . :
JMSF036J24+ TTATAGGGAAGGAAGCCATTAATGGAGAGAGGTAGCTGAATTTGTTTGGT
JMSF023L09+ TTATAGGGAAGGAAGCCATTAATGGAGAGAGGTAGCTGAATTTGTTTGGT
JMFF021E18+ TTATAGGGAAGGAAGCCATTAATGGAGAGAGGTAGCTGAATTTGTTTGGTGCAGCGATGA
JMFF008G09+ TTATAGGGAAGGAAGCCATTAATGGAGAGAGGTAGCTGAATTTGTTTGGTGCAGCGATGA
                      ____________________________________________________________
consensus TTATAGGGAAGGAAGCCATTAATGGAGAGAGGTAGCTGAATTTGTTTGGTGCAGCGATGA