Previous Contig 000418:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008C05Sequence511000418 (9)gb:AF484959_18040673e-77Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287743020812gb:AF484959_18040671e-80Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287
JMFF019F11Sequence506000418 (9)gb:AF484959_18040677e-79Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287733000418 (9)gb:AF484959_18040677e-90Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287
JMFF019O13Sequence511000418 (9)gb:AF484959_18040675e-78Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287695000418 (9)gb:AF484959_18040679e-76Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287
JMSF023P23Sequence647000418 (9)gb:AF484959_1804067e-113Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287745000418 (9)gb:AF484959_18040671e-88Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287
JMSF049K20Sequence692000418 (9)gb:AF484959_1804067e-105Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287691000418 (9)gb:AF484959_18040672e-81Gossypium hirsutum tubulin beta-1 (Tub1) mRNA, complete cds.>gb:AF487511_1804287

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF019O13- ATAGTAGAGAGAACAAATCACTTAACACAATGTAGCAAT
rJMSF049K20- AT
rJMFF019F11- AT
                      ____________________________________________________________
consensus ATAGTAGAGAGAACAAATCACTTAACACAATGTAGCAAT
 
. : . : . : . : . : . :
rJMFF019O13- ACTACAAG-TCTACAACACAGTACCATCTCCAAAGATTATAAAAGCTAACATGTCTGGAC
rJMSF049K20- ACTACAAGNTCTACAACACAGTACCATCTCCAAAGATTATAAAAGCTAACATGTCTGGAC
rJMFF019F11- ACTACAAG-TCTACAACACAGTACCATCTCCAAAGATTATAAAAGCTAACATGTCTGGAC
                      ____________________________________________________________
consensus ACTACAAG-TCTACAACACAGTACCATCTCCAAAGATTATAAAAGCTAACATGTCTGGAC
 
. : . : . : . : . : . :
rJMFF019O13- AACAACAAAAAGCTCATCCATAAGCATGGATGATGCAACATCAAACACTAGAATTCATTA
rJMSF049K20- AACAACAAAAAGCTCATCCATAAGCATGGATGATGCAACATCAAACACTAGAATTCATTA
rJMFF019F11- AACAACAAAAAGCTCATCCATAAGCATGGATGATGCAACATCAAACACTAGAATTCATTA
                      ____________________________________________________________
consensus AACAACAAAAAGCTCATCCATAAGCATGGATGATGCAACATCAAACACTAGAATTCATTA
 
. : . : . : . : . : . :
rJMFF019O13- ACATACAACAACACAACTGCTG-TTTCCAAGGAAACCAGATTGAGATGATTGCATGCTTA
rJMSF049K20- ACATACAACAACACAACTGCTGTTTTCCAAGGAAACCAGATTGAGATGATTGCATGCTTA
rJMFF019F11- ACATACAACAACACAACTGCTGTTTTCCAAGGAAACCAGATTGAGATGATTGCATGCTTA
                      ____________________________________________________________
consensus ACATACAACAACACAACTGCTGTTTTCCAAGGAAACCAGATTGAGATGATTGCATGCTTA
 
. : . : . : . : . : . :
rJMFF019O13- GGCCTCCTCCTCGTCCTGGTACTCTTCATCTTCGTATTCTTCGTCTGCAGTAGCATCCTG
rJMSF049K20- GGCCTCCTCCTCGTCCTGGTACTCTTCATCTTCGTATTCTTCGTCTGCAGTAGCATCCTG
rJMSF023P23- TTCTTCGTCTGCAGTAGCATCCTG
rJMFF019F11- GGCCTCCTCCTCGTCCTGGTACTCTTCATCTTCGTATTCTTCGTCTGCAGTAGCATCCTG
                      ____________________________________________________________
consensus GGCCTCCTCCTCGTCCTGGTACTCTTCATCTTCGTATTCTTCGTCTGCAGTAGCATCCTG
 
. : . : . : . : . : . :
rJMFF019O13- GTACTGCTGGTACTCTGCCACCAAGTCATTCATATTGCTTTCGGCTTCTGTGAACTCCAT
rJMSF049K20- GTACTGCTGGTACTCTGCCACCAAGTCATTCATATTGCTTTCGGCTTCTGTGAACTCCAT
rJMSF023P23- GTACTGCTGGTACTCTGCCACCAAGTCATTCATATTGCTTTCGGCTTCTGTGAACTCCAT
rJMFF019F11- GTACTGCTGGTACTCTGCCACCAAGTCATTCATATTGCTTTCGGCTTCTGTGAACTCCAT
                      ____________________________________________________________
consensus GTACTGCTGGTACTCTGCCACCAAGTCATTCATATTGCTTTCGGCTTCTGTGAACTCCAT
 
. : . : . : . : . : . :
rJMFF019O13- TTCATCCATTCCCTCTCCTGTGTACCAGTGCAAGAAAGCCTTCCTGCGGAACATGGCAGT
rJMSF049K20- TTCATCCATTCCCTCTCCTGTGTACCAGTGCAAGAAAGCCTTCCTGCGGAACATGGCAGT
rJMSF023P23- TTCATCCATTCCCTCTCCTGTGTACCAGTGCAAGAAAGCCTTCCTGCGGAACATGGCAGT
rJMFF019F11- TTCATCCATTCCCTCTCCTGTGTACCAGTGCAAGAAAGCCTTCCTGCGGAACATGGCAGT
                      ____________________________________________________________
consensus TTCATCCATTCCCTCTCCTGTGTACCAGTGCAAGAAAGCCTTCCTGCGGAACATGGCAGT
 
. : . : . : . : . : . :
rJMFF019O13- GAACTGCTCGCTAACCCTCCTGAACATCTCCTGGATGGATGTGGAGTTACCAATGAATGT
rJMSF049K20- GAACTGCTCGCTAACCCTCCTGAACATCTCCTGGATGGATGTGGAGTTACCAATGAATGT
rJMSF023P23- GAACTGCTCGCTAACCCTCCTGAACATCTCCTGGATGGATGTGGAGTTACCAATGAATGT
rJMFF019F11- GAACTGCTCGCTAACCCTCCTGAACATCTCCTGGATGGATGTGGAGTTACCAATGAATGT
                      ____________________________________________________________
consensus GAACTGCTCGCTAACCCTCCTGAACATCTCCTGGATGGATGTGGAGTTACCAATGAATGT
 
. : . : . : . : . : . :
rJMFF019O13- TGAGGCCATCTTCAGACCGATTGGTGGGATGTCACATACAGTGGATTTCACATTGTTCGG
rJMSF049K20- TGAGGCCATCTTCAGACCGATTGGTGGGATGTCACATACAGTGGATTTCACATTGTTCGG
rJMSF023P23- TGAGGCCATCTTCAGACCGATTGGTGGGATGTCACATACAGTGGATTTCACATTGTTCGG
rJMFF019F11- TGAGGCCATCTTCAGACCGATTGGTGGGATGTCACATACAGTGGATTTCACATTGTTCGG
JMSF023P23+ TCGG
                      ____________________________________________________________
consensus TGAGGCCATCTTCAGACCGATTGGTGGGATGTCACATACAGTGGATTTCACATTGTTCGG
 
. : . : . : . : . : . :
rJMFF019O13- GATCCACTCAACAAAGTATGATGAGTTCTTGTTCTGAACGTTGATCATCTGCTCATCAAC
rJMSF049K20- GATCCACTCAACAAAGTATGATGAGTTCTTGTTCTGAACGTTGATCATCTGCTCATCAAC
rJMSF023P23- GATCCACTCAACAAAGTATGATGAGTTCTTGTTCTGAACGTTGATCATCTGCTCATCAAC
rJMFF019F11- GATCCACTCAACAAAGTATGATGAGTTCTTGTTCTGAACGTTGATCATCTGCTCATCAAC
JMSF023P23+ GATCCACTCAACAAAGTATGATGAGTTCTTGTTCTGAACGTTGATCATCTGCTCATCAAC
                      ____________________________________________________________
consensus GATCCACTCAACAAAGTATGATGAGTTCTTGTTCTGAACGTTGATCATCTGCTCATCAAC
 
. : . : . : . : . : . :
rJMFF019O13- CTCCTTGGTGCTCATCTTGCCACGGAAGACTGCGGATGCAGTGAGATACCTGCCGTGACG
rJMSF049K20- CTCCTTGGTGCTCATCTTGCCACGGAAGACTGCGGATGCAGTGAGATACCTGCCGTGACG
rJMSF023P23- CTCCTTGGTGCTCATCTTGCCACGGAAGACTGCGGATGCAGTGAGATACCTGCCGTGACG
rJMFF019F11- CTCCTTGGTGCTCATCTTGCCACGGAAGACTGCGGATGCAGTGAGATACCTGCCGTGACG
JMSF023P23+ CTCCTTGGTGCTCATCTTGCCACGGAAGACTGCGGATGCAGTGAGATACCTGCCGTGACG
                      ____________________________________________________________
consensus CTCCTTGGTGCTCATCTTGCCACGGAAGACTGCGGATGCAGTGAGATACCTGCCGTGACG
 
. : . : . : . : . : . :
rJMFF019O13- AGGATCAGCAGCACACATCATGTTTTTCGCATCCCACATTTGTTGGGTGAGCTCTGGG
rJMSF049K20- AGGATCAGCAGCACACATCATGTTTTTCGCATCCCACATTTGTTGGGTGAGCTCTGGGAC
rJMSF023P23- AGGATCAGCAGCACACATCATGTTTTTCGCATCCCACATTTGTTGGGTGAGCTCTGGGAC
rJMFF019F11- AGGATCAGCAGCACACATCATGTTTTTCGCATCCCACATTTGTTGGGTGAGCTCTGGGAC
JMSF023P23+ AGGATCAGCAGCACACATCATGTTTTTCGCATCCCACATTTGTTGGGTGAGCTCTGGGAC
                      ____________________________________________________________
consensus AGGATCAGCAGCACACATCATGTTTTTCGCATCCCACATTTGTTGGGTGAGCTCTGGGAC
 
. : . : . : . : . : . :
rJMSF049K20- AGTGAGGGCCCGGTACTGCTGTGAACCAC
rJMSF023P23- AGTGAGGGCCCGGTACTGCTGTGAACCACGAGATGTAAGGGGAGCAAAGCCAACCATAAA
rJMFF019F11- AGTGAGGGCCCGGTACTGCTGTGAACCACGAAATGTAAGGGGAGCAAAGCCAACCATAAA
JMSF023P23+ AGTGAGGGCCCGGTACTGCTGTGAACCACGAGATGTAAGGGGAGCAAAGCCAACCATAAA
                      ____________________________________________________________
consensus AGTGAGGGCCCGGTACTGCTGTGAACCACGAGATGTAAGGGGAGCAAAGCCAACCATAAA
 
. : . : . : . : . : . :
rJMSF023P23- GAA
rJMFF019F11- GAA
JMSF023P23+ GAAGTGGAGCCGAGGGAAAGGAATGAGATTCACTGCCAGCTTGCGCAGATCTGAGTTGAG
                      ____________________________________________________________
consensus GAAGTGGAGCCGAGGGAAAGGAATGAGATTCACTGCCAGCTTGCGCAGATCTGAGTTGAG
 
. : . : . : . : . : . :
JMSF023P23+ CTGACCAGGGAAGCGAAGGCAGCAAGTGACACCACTCATGGTGGCCGAGATCAAGTGATT
                      ____________________________________________________________
consensus CTGACCAGGGAAGCGAAGGCAGCAAGTGACACCACTCATGGTGGCCGAGATCAAGTGATT
 
. : . : . : . : . : . :
JMSF023P23+ CAAATCTCCAAAGCTGGGAGTGGTGAGCTTGAGAGTGCGGAAGCAAATATCATACAAAGC
                      ____________________________________________________________
consensus CAAATCTCCAAAGCTGGGAGTGGTGAGCTTGAGAGTGCGGAAGCAAATATCATACAAAGC
 
. : . : . : . : . : . :
JMSF023P23+ CTCATTATCCAACACCATACACTCATCCGCATTTTCAACCAGCTGATGCACTGAGAGCGT
JMSF049K20+ ACACCATACANTCATCCGCATTTTCAACCAGCTGATGCACTGAGAGCGT
                      ____________________________________________________________
consensus CTCATTATCCAACACCATACACTCATCCGCATTTTCAACCAGCTGATGCACTGAGAGCGT
 
. : . : . : . : . : . :
JMSF023P23+ CGCGTTGTAAGGCTCCACCACCGTGTCGGACACCTTGGGCGATGGAAACACCGAGAAAGT
JMSF049K20+ CGCGTTGTAAGGCTCCACCACCGTGTCGGACACCTTGGGCGATGGAAACACCGAGAAAGT
                      ____________________________________________________________
consensus CGCGTTGTAAGGCTCCACCACCGTGTCGGACACCTTGGGCGATGGAAACACCGAGAAAGT
 
. : . : . : . : . : . :
JMSF023P23+ CAGCATCATCCGGTCAGGGTATTCCTCCCTTATCTTTGATATCAACAGTGTCCCCATACC
JMSF049K20+ CAGCATCATCCGGTCAGGGTATTCCTCCCTTATCTTTGATATCAACAGTGTCCCCATACC
JMFF019O13+ TTATCTTAGATATCAACAGTGTCCCCATACC
JMFF008C05+ TTATCTTTGATATCAACAGTGTCCCCATACC
                      ____________________________________________________________
consensus CAGCATCATCCGGTCAGGGTATTCCTCCCTTATCTTTGATATCAACAGTGTCCCCATACC
 
. : . : . : . : . : . :
JMSF023P23+ CGACCCGGTTCCTCCTCCCAGAGAATGACATACTTGAAACCC
JMSF049K20+ CGACCCGGTTCCTCCTCCCAGAGAATGACATACTTGAAACCCTTGGAGACAATCGCAGTT
JMFF019F11+ TCCCAGAGAATGACATACTTGAAACCCTTGGAGACAATCGCAGTT
JMFF019O13+ CGACCCGGTTCCTCCTCCCAGAGAATGACATACTTGAAACCCTTGGAGACAATCGCAGTT
JMFF008C05+ CGACCCGGTTCCTCCTCCCAGAGAATGACATACTTGAAACCCTTGGAGACAATCGCAGTT
                      ____________________________________________________________
consensus CGACCCGGTTCCTCCTCCCAGAGAATGACATACTTGAAACCCTTGGAGACAATCGCAGTT
 
. : . : . : . : . : . :
JMSF049K20+ CTCGGCCTCTTTGCGGACGACATCGAGAACAGAGTCGATGAGCTCAGCGCCCTCAGTGTA
JMFF019F11+ CTCGGCCTCTTTGCGGACGACATCGAGAACAGAGTCGATGAGCTCAGCGCCCTCAGTGTA
JMFF019O13+ CTCGGCCTCTTTGCGGACGACATCGAGAACAGAGTCGATGAGCTCAGCGCCCTCAGTGTA
JMFF008C05+ CTCGGCCTCTTTGCGGACGACATCGAGAACAGAGTCGATGAGCTCAGCGCCCTCAGTGTA
                      ____________________________________________________________
consensus CTCGGCCTCTTTGCGGACGACATCGAGAACAGAGTCGATGAGCTCAGCGCCCTCAGTGTA
 
. : . : . : . : . : . :
JMSF049K20+ GTGTCCCTTGGCCCAGTTGTTGCCGGCGCCGGACTGGCCGAAGACGAAGTTGTCAGGGCG
JMFF019F11+ GTGTCCCTTGGCCCAGTTGTTGCCGGCGCCGGACTGGCCGAAGACGAAGTTGTCAGGGCG
JMFF019O13+ GTGTCCCTTGGCCCAGTTGTTGCCGGCGCCGGACTGGCCGAAGACGAAGTTGTCAGGGCG
JMFF008C05+ GTGTCCCTTGGCCCAGTTGTTGCCGGCGCCGGACTGGCCGAAGACGAAGTTGTCAGGGCG
                      ____________________________________________________________
consensus GTGTCCCTTGGCCCAGTTGTTGCCGGCGCCGGACTGGCCGAAGACGAAGTTGTCAGGGCG
 
. : . : . : . : . : . :
JMSF049K20+ GAAGATCTGGCCGTAGGGGCCGGAGCGGACGGAGTCCATGGTGCCAGGCTCGAGATCCAT
JMFF019F11+ GAAGATCTGGCCGTAGGGGCCGGAGCGGACGGAGTCCATGGTGCCAGGCTCGAGATCCAT
JMFF019O13+ GAAGATCTGGCCGTAGGGGCCGGAGCGGACGGAGTCCATGGTGCCAGGCTCGAGATCCAT
JMFF008C05+ GAAGATCTGGCCGTAGGGGCCGGAGCGGACGGAGTCCATGGTGCCAGGCTCGAGATCCAT
                      ____________________________________________________________
consensus GAAGATCTGGCCGTAGGGGCCGGAGCGGACGGAGTCCATGGTGCCAGGCTCGAGATCCAT
 
. : . : . : . : . : . :
JMSF049K20+ GAGGACGGCGCGGGGGACGAAGCGGCCGCAGCTAGCCTCGTTGTAGTAGACGTTGACGCG
JMFF019F11+ GAGGACGGCGCGGGGGACGAAGCGGCCGCAGCTAGCCTCGTTGTAGTAGACGTTGACGCG
JMFF019O13+ GAGGACGGCGCGGGGGACGAAGCGGCCGCAGCTAGCCTCGTTGTAGTAGACGTTGACGCG
JMFF008C05+ GAGGACGGCGCGGGGGACGAAGCGGCCGCAGCTAGCCTCGTNGTAGTAGACGTTGACGCG
                      ____________________________________________________________
consensus GAGGACGGCGCGGGGGACGAAGCGGCCGCAGCTAGCCTCGTTGTAGTAGACGTTGACGCG
 
. : . : . : . : . : . :
JMSF049K20+ CTCGAGCTGGAGATCGGAGTCGCCATGGTAGCGGCCGGTGGAGTCGATCCCGTGCTCGGC
JMFF019F11+ CTCGAGCTGGAGATCGGAGTCGCCATGGTAGCGGCCGGTGGAGTCGATCCCGTGCTCGGC
JMFF019O13+ CTCGAGCTGGAGATCGGAGTCGCCATGGTAGCGGCCGGTGGAGTCGATCCCGTGCTCGGC
JMFF008C05+ CTCGAGCTGGAGATCGGAGTCGCCATGGTAGCGGCCGGTGGAGTCGATCCCGTGCTCGGC
                      ____________________________________________________________
consensus CTCGAGCTGGAGATCGGAGTCGCCATGGTAGCGGCCGGTGGAGTCGATCCCGTGCTCGGC
 
. : . : . : . : . : . :
JMSF049K20+ GCAGACCACCTCCCAGAACTTGGCTCCGATCTGGTTGCCGCATTGGCCGCCTTGGATGTG
JMFF019F11+ GCAGACCACCTCCCAGAACTTGGCTCCGATCTGGTTGCCGCATTGGCCGCCTTGGATGTG
JMFF019O13+ GCAGACCACCTCCCAGAACTTGGCTCCGATCTGGTTGCCGCATTGGCCGCCTTGGATGTG
JMFF008C05+ GCAGACCACCTCCCAGAACTTGGCTCCGATCTGGTTGCCGCATTGGCCGCCTTGGATGTG
                      ____________________________________________________________
consensus GCAGACCACCTCCCAGAACTTGGCTCCGATCTGGTTGCCGCATTGGCCGCCTTGGATGTG
 
. : . : . : . : . : . :
JMSF049K20+ AAGAATCTCGCGCAT
JMFF019F11+ AAGAATCTCGCGCAT
JMFF019O13+ AAGAATCTCGCGCATTTTGGTCGGAGACGGAGGAGAGAGATTGGGGGAAAAGTAGAGAGT
JMFF008C05+ AAGAATCTCGCGCATTTTGGTCGGAGACGGAGGAGAGAGATTGGGGGAAAAGTAGAGAGT
                      ____________________________________________________________
consensus AAGAATCTCGCGCATTTTGGTCGGAGACGGAGGAGAGAGATTGGGGGAAAAGTAGAGAGT