Previous Contig 000407:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007P02Sequence571000407 (7)gb:BT011692_16412147e-25Arabidopsis thaliana At3g14067 gene, complete cds.>gb:BT012275_1641481 Arabidops640006046 (6)gb:AP004846_18458842e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMFF029B20Sequence410000407 (7)pir|S52769|S527699e-16subtilisin-like proteinase ag12 (EC 3.4.21.-) - alder>gb:AGAG12_1811002 A.glutin689006046 (6)gb:AP004846_18458842e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF004P10Sequence286000407 (7)pir|S52769|S527692e-06subtilisin-like proteinase ag12 (EC 3.4.21.-) - alder>gb:AGAG12_1811002 A.glutin377011083 (3)pir|T07172|T071722e-09subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi
JMSF019M15Sequence447000407 (7)pir|S52769|S527693e-16subtilisin-like proteinase ag12 (EC 3.4.21.-) - alder>gb:AGAG12_1811002 A.glutin749006046 (6)gb:AP004846_18458843e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF022M16Sequence675000407 (7)gb:BT011692_16412141e-43Arabidopsis thaliana At3g14067 gene, complete cds.>gb:BT012275_1641481 Arabidops766006046 (6)gb:AP004846_18458842e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF031H07Sequence628000407 (7)gb:BT011692_16412147e-47Arabidopsis thaliana At3g14067 gene, complete cds.>gb:BT012275_1641481 Arabidops726011083 (3)gb:AP004846_18458846e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF053G13Sequence645000407 (7)gb:BT011692_16412141e-47Arabidopsis thaliana At3g14067 gene, complete cds.>gb:BT012275_1641481 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022M16+ CGAAAAGGTTAGCGTTCGCAACAGCAGATCCAGCTGCAGTAGAG
                      ____________________________________________________________
consensus CGAAAAGGTTAGCGTTCGCAACAGCAGATCCAGCTGCAGTAGAG
 
. : . : . : . : . : . :
JMSF022M16+ GCAACATGTGTGCCATGCCCGGTCATATCTATCGCTGATTTAGGTTCATCAACTATTGGC
                      ____________________________________________________________
consensus GCAACATGTGTGCCATGCCCGGTCATATCTATCGCTGATTTAGGTTCATCAACTATTGGC
 
. : . : . : . : . : . :
JMSF022M16+ CTTCCAGTAACAGCTTCGTAACCTCTGTAATAAGCACGAGCACCAATGATTTTCCGATTA
                      ____________________________________________________________
consensus CTTCCAGTAACAGCTTCGTAACCTCTGTAATAAGCACGAGCACCAATGATTTTCCGATTA
 
. : . : . : . : . : . :
JMSF022M16+ CACGAAGTCGCCGGAAACTGTGGACCAACCTCGCACTTGTTCCTCCAGTCGTTAGGAACG
JMFF007P02+ ACCTCGCACTTGTTCCTCCAGTCGTTAGGAACG
                      ____________________________________________________________
consensus CACGAAGTCGCCGGAAACTGTGGACCAACCTCGCACTTGTTCCTCCAGTCGTTAGGAACG
 
. : . : . : . : . : . :
JMSF022M16+ GGGGATAGACCCTGGTCGGAGAAGCTAGACCTTTGGGGCCAGATTCCACTGTCCAGAACA
JMFF007P02+ GGGGATAGACCCTGGTCGGAGAAGCTAGACCTTTGGGGCC--ATTCCACTGTCCAGAACA
                      ____________________________________________________________
consensus GGGGATAGACCCTGGTCGGAGAAGCTAGACCTTTGGGGCCAGATTCCACTGTCCAGAACA
 
. : . : . : . : . : . :
JMSF022M16+ CCGACTATAATTTCAGCTCCGTAATCAGAGCTAGGCCAGAGACTAGATGCGGCAGAACTA
JMFF007P02+ CCGACTATAATTTCAGCTCCGTAATCAGAGCTAGGCCAGAGACTAGATGCGGCAGAACTA
                      ____________________________________________________________
consensus CCGACTATAATTTCAGCTCCGTAATCAGAGCTAGGCCAGAGACTAGATGCGGCAGAACTA
 
. : . : . : . : . : . :
JMSF022M16+ CTTAAGCCTAAGAATTGAGGAGTCCTAGTGGTTTGGAGCTCGAGGAGGTCATCCCGAAGG
JMSF019M15+ TTAAGCCTAAGAATTGAGGAGTCCTAGTGGTTTGGAGCTCGAGGAGGTCATCCCGAAGG
JMFF029B20+ AGAATTGAGGAGTCCTAGTGGTTTGGAGCTCGAGGAGGTCATCCCGAAGG
JMSF031H07+ TTAAGCCTAAGAATTGAGGAGACCTAGTGGTCTGGAGCTCGACGAGGCGATCCGGAAGG
JMSF053G13+ TTAAGCCTAAGAATTGAGGAGACCTAGTGGTCTGGAGCTCGACGAGGCGATCCGGAAGG
JMFF007P02+ CTTAAGCCTAAGAATTGAGGAGTCCTAGTGGTTTGGAGCTCGAGGAGGTCATCCCGAAGG
                      ____________________________________________________________
consensus CTTAAGCCTAAGAATTGAGGAGTCCTAGTGGTTTGGAGCTCGAGGAGGTCATCCCGAAGG
 
. : . : . : . : . : . :
JMSF022M16+ ACAGAGATCACACCCGGAACGTTTTCTAGTTCAGACGCTTGGGAAGGAGTCAGGCTTGCA
JMSF019M15+ ACAGAGATCACACCCGGAACGTTTTCTAGTTCAGACGCTTGGGAAGGAGTCAGGCTTGCA
JMFF029B20+ ACAGAGATCACACCCGGAACGTTTTCTAGTTCAGACGCTTGGGAAGGAGTCAGGCTTGCA
JMSF031H07+ ACAGAGATCACTCCCGGAACGTTTGCTAGTTCAGACGCTTGGGAGGGAGTGAGGCGTGCA
JMSF053G13+ ACAGAGATCACTCCCGGAACGTTTGCTAGTTCAGACGCTTGGGAGGGAGTGAGGCGTGCA
JMFF007P02+ ACAGAGATCACACCCGGAACGTTTTCTAGTTCAGACGCTTGGGAAGGAGTCAGGCTTGCA
                      ____________________________________________________________
consensus ACAGAGATCACACCCGGAACGTTTTCTAGTTCAGACGCTTGGGAAGGAGTCAGGCTTGCA
 
. : . : . : . : . : . :
JMSF022M16+ GAAAAACCATGGGCAACATGTTCATAGGTGTACAAGAGCTCGGATGATCTTGAGTGGTTA
JMSF019M15+ GAAAAACCATGGGCAACATGTTCATAGGTGTACAAGAGCTCGGATGATCTTGAGTGGTTA
JMFF029B20+ GAAAAACCATGGGCAACATGTTCATAGGTGTACAAGAGCTCGGATGATCTTGAGTGGTTA
JMSF031H07+ GAAAAACCATGCGCAACATGTTCATAGGTGTACAAGAGCTCAGATGATCTTGAGTGGTTA
JMSF053G13+ GAAAAACCATGCGCAACATGTTCATAGGTGTACAAGAGCTCAGATGATCTTGAGTGGTTA
JMSF004P10+ CCATGCGCAACATGTTCATAGGTGTACAAGAGCTCAGATGATCTTGAGTGGTTA
JMFF007P02+ GAAAAACCATGGGCAACATGTTCATAGGTGTACAAGAGCTCGGATGATCTTGAGTGGTTA
                      ____________________________________________________________
consensus GAAAAACCATGGGCAACATGTTCATAGGTGTACAAGAGCTCGGATGATCTTGAGTGGTTA
 
. : . : . : . : . : . :
JMSF022M16+ GAGAGAGGAGAGAGTGTATGGATAATGGATGAATACCAGTCATGATGGGTAGAGAAAAGC
JMSF019M15+ GAGAGAGGAGAGAGTGTATGGATAATGGATGAATACCAGTCATGATGGGTAGAGAAAAGC
JMFF029B20+ GAGAGAGGAGAGAGTGTATGGATAATGGATGAATACCAGTCATGATGGGTAGAGAAAAGC
JMSF031H07+ GAGAGAGGAGAAAGGGTATGGATGATGGATGAATACCAGTCATGATGGGTAGAGAAAAGC
JMSF053G13+ GAGAGAGGAGAAAGGGTATGGATGATGGATGAATACCAGTCATGATGGGTAGAGAAAAGC
JMSF004P10+ GAGAGAGGAGAAAGGGTATGGATGATGGATGAATACCAGTCATGATGGGTAGAGAAAAGC
JMFF007P02+ GAGAGAGGAGAGAGTGTATGGATAATGGATGAATACCAGTCATGATGGGTAGAGAAAAGC
                      ____________________________________________________________
consensus GAGAGAGGAGAGAGTGTATGGATAATGGATGAATACCAGTCATGATGGGTAGAGAAAAGC
 
. : . : . : . : . : . :
JMSF022M16+ TGAGGCTTCTCAAATTTCGACATGAAAACGATGAAGCTCTTGGGTTCCTCCAATGAAGAA
JMSF019M15+ TGAGGCTTCTCAAATTTCGACATGAAAACGATGAAGCTCTTGGGTTCCTCCAATGAAGAA
JMFF029B20+ TGAGGCTTCTCAAATTTCGACATGAAAACGATGAAGCTCTTGGGTTCCTCCAATGAAGAA
JMSF031H07+ TGAGGCTTCTCAGATTTCATCATGAAAACGATGAAGCTCTTGGGTTCCTCCAATGAAGAA
JMSF053G13+ TGAGGCTTCTCAGATTTCATCATGAAAACGATGAAGCTCTTGGGTTCCTCCAATGAAGAA
JMSF004P10+ TGAGGCTTCTCAGATTTCATCATGAAAACGATGAAGCTCTTGGGTTCCTCCAATGAAGAA
JMFF007P02+ TGAGGCTTCTCAAATTTCGACATGAAAACGATGAAGCTCTTGGGTTCCTCCAATGAAGAA
                      ____________________________________________________________
consensus TGAGGCTTCTCAAATTTCGACATGAAAACGATGAAGCTCTTGGGTTCCTCCAATGAAGAA
 
. : . : . : . : . : . :
JMSF022M16+ ACCGAAACCCTGCAGACTGAAAGGAGACAT
JMSF019M15+ ACCGAAACCCTGCAGACTGAAAGGAGACATAAGAAGAGTATGAAGAGAAAGGAGGTTGGA
JMFF029B20+ ACCGAAACCCTGCAGACTGAAAGGAGACATAAGAAGAGTATGAAGAGAAAGGAGGTTGGA
JMSF031H07+ ACCGAAACCCTGCAGACTGAAAGGAGACATAAGATGAATATGAAGAGAAAGGAACTTGGA
JMSF053G13+ ACCGAAACCCTGCAGACTGAAAGGAGACATAAGATGAATATGAAGAGAAAGGAACTTGGA
JMSF004P10+ ACCGAAACCCTGCAGACTGAAAGGAGACATAAGATGAATATGAAGAGAAAGGAACTTGGA
JMFF007P02+ ACCGAAACCCTGCAGACTGAAAGGAGACATAAGAAGAGTATGAAGAGAAAGGAGGTTGGA
                      ____________________________________________________________
consensus ACCGAAACCCTGCAGACTGAAAGGAGACATAAGATGAGTATGAAGAGAAAGGAGGTTGGA
 
. : . : . : . : . : . :
JMSF019M15+ GCGAGAA
JMFF029B20+ GCGAGAA
JMSF031H07+ GCGAGAA
JMSF053G13+ GCGAGAA
JMSF004P10+ GCGAGAA
JMFF007P02+ GCGAGAAGTGCAGCCATTATATTATATTATGCATGCATGTATATTGATGATTTGATGATA
                      ____________________________________________________________
consensus GCGAGAAGTGCAGCCATTATATTATATTATGCATGCATGTATATTGATGATTTGATGATA