Previous Contig 000404:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007O03Sequence575000404 (3)gb:AY049245_15618872e-78Arabidopsis thaliana AT4g26270/T25K17_80 mRNA, complete cds.>gb:AY090267_1574019776008517 (3)gb:AY088020_15730441e-50Arabidopsis thaliana clone 40445 mRNA, complete sequence.
JMSF003O08Sequence214000404 (3)gb:AP002743_18226938e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P071696008517 (3)gb:AY088020_15730441e-50Arabidopsis thaliana clone 40445 mRNA, complete sequence.
JMSF018F22Sequence237000404 (3)gb:AP002743_18226932e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P071795008517 (3)pir|T13433|T134332e-54pyrophosphate-dependent phosphofructo-1-kinase homolog T17A13.40 - Arabidopsis t

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007O03+ TTGTAGTGTCATGACCCCCTCGAGATGTTCCAAGG
                      ____________________________________________________________
consensus TTGTAGTGTCATGACCCCCTCGAGATGTTCCAAGG
 
. : . : . : . : . : . :
JMFF007O03+ ATTGTACCACCACGTTTATGTATGTCATTTACAAGCTTTGGGGTTAAATTGATGGTATTC
                      ____________________________________________________________
consensus ATTGTACCACCACGTTTATGTATGTCATTTACAAGCTTTGGGGTTAAATTGATGGTATTC
 
. : . : . : . : . : . :
JMFF007O03+ TTGGCATAGAAACCCCTATAGCCTCCATCAATCCCAAGGACTTTGTTGACACCATACATG
                      ____________________________________________________________
consensus TTGGCATAGAAACCCCTATAGCCTCCATCAATCCCAAGGACTTTGTTGACACCATACATG
 
. : . : . : . : . : . :
JMFF007O03+ TAATCAAGGCTGTGAACAATTTCCCTGATGACAGTATTTAGGCCAGGGCATAAACCACCA
                      ____________________________________________________________
consensus TAATCAAGGCTGTGAACAATTTCCCTGATGACAGTATTTAGGCCAGGGCATAAACCACCA
 
. : . : . : . : . : . :
JMFF007O03+ CATGTTACAATGCAGGCATGCACATCATCTGAATTAAAATAAACCTTCTGACGAGGACCA
                      ____________________________________________________________
consensus CATGTTACAATGCAGGCATGCACATCATCTGAATTAAAATAAACCTTCTGACGAGGACCA
 
. : . : . : . : . : . :
JMFF007O03+ GCACGCCTAAAATGCACCCCTCTTGGACTATCAAGGTGAACAACAACCTTCTGGGGAACT
                      ____________________________________________________________
consensus GCACGCCTAAAATGCACCCCTCTTGGACTATCAAGGTGAACAACAACCTTCTGGGGAACT
 
. : . : . : . : . : . :
JMSF018F22+ TATCCTCCATGTNTACAAAGTACTGCTTCACAACGGAATATGCAGGATTGGACCGGAGT
JMSF003O08+ TACAAAGTACTGCTTCACAACGGAATATGCAGGATTGGACCGGAGT
JMFF007O03+ GTATCCTCCATGTCTACAAAGTACTGCTTCACAACGGAATATGCAGGATTGGACCGGAGT
                      ____________________________________________________________
consensus GTATCCTCCATGTCTACAAAGTACTGCTTCACAACGGAATATGCAGGATTGGACCGGAGT
 
. : . : . : . : . : . :
JMSF018F22+ GGGTTTGGATAAGTTGGAAGATCAGGGATGTAATCGGTGAGGTGAGGAACATCTTCAAGC
JMSF003O08+ GGGTTTGGATAAGTTGGAAGATCAGGGATGTAATCGGTGAGGTGAGGAACATCTTCAAGC
JMFF007O03+ GGGTTTGGATAAGTTGGAAGATCAGGGATGTAATCGGTGAGGTGAGGAACATCTTCAAGC
                      ____________________________________________________________
consensus GGGTTTGGATAAGTTGGAAGATCAGGGATGTAATCGGTGAGGTGAGGAACATCTTCAAGC
 
. : . : . : . : . : . :
JMSF018F22+ ACATAGCCAAAGTCTCCTTTGACGATCTTCATCTGACAATTGCTTTCTCCTCCTCCTGCG
JMSF003O08+ ACATAGCCAAAGTCTCCTTTGACGATCTTCATCTGACAATTGCTTTCTCCTCCTCCTGCG
JMFF007O03+ ACATAGCCAAAGTCTCCTTTGACGATCTTCATCTGACAATTGCTTTCTCCTCCTCCTGCG
                      ____________________________________________________________
consensus ACATAGCCAAAGTCTCCTTTGACGATCTTCATCTGACAATTGCTTTCTCCTCCTCCTGCG
 
. : . : . : . : . : . :
JMSF018F22+ GCCATCTTCTTCTTCTTTTCCGGATTGTTCTTCAATTTTCGTCTGGGTTTCTTCTCT
JMSF003O08+ GCCATCTTCTTCTTCTTTTCCGGATTGTTCTTCAATTTTCGTC
JMFF007O03+ GCCATCTTCTTCTTCTTTTCCGGATTGTTCTTCAATTTTCGTCTGGGTTTCTTCTCTGCC
                      ____________________________________________________________
consensus GCCATCTTCTTCTTCTTTTCCGGATTGTTCTTCAATTTTCGTCTGGGTTTCTTCTCTGCC