Previous Contig 000400:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007M20Sequence560000400 (8)gb:AC144735_17441201e-22Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0001A14, complet
JMFF018H06Sequence523000400 (8)gb:AC144735_17441209e-22Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0001A14, complet602009417 (4)gb:AY078955_15681107e-25Arabidopsis thaliana AT5g19580/T20D1_100 mRNA, complete cds.>gb:BT001150_1635405
JMFF028L06Sequence325000400 (8)gb:AY058872_15644089e-05Arabidopsis thaliana At1g19900/F6F9_4 mRNA, complete cds.421009417 (4)gb:AY078955_15681103e-15Arabidopsis thaliana AT5g19580/T20D1_100 mRNA, complete cds.>gb:BT001150_1635405
JMFF040L04Sequence524000400 (8)gb:AC144735_17441201e-22Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0001A14, complet662009417 (4)gb:AY078955_15681101e-31Arabidopsis thaliana AT5g19580/T20D1_100 mRNA, complete cds.>gb:BT001150_1635405
JMFF041I21Sequence614000400 (8)gb:AC144735_17441204e-15Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0001A14, complet
JMFN016M08Sequence618000400 (8)gb:AC144735_17441205e-29Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0001A14, complet
JMFS033A04Sequence615000400 (8)gb:AP003335_18281434e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMFS059G07Sequence641000400 (8)gb:AP003335_18281431e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040L04+ CTTGAAATCGCATAAATCGCAGGGTTCCAGGA
JMFF018H06+ GAAATCGCATAAATCGCAGGGTTCCAGGA
JMFF007M20+ GAAATCGCATAAATCGCAGGGTTCCAGGA
                      ____________________________________________________________
consensus CTTGAAATCGCATAAATCGCAGGGTTCCAGGA
 
. : . : . : . : . : . :
JMFF040L04+ TTCTAATTCCTCGAAAACCTTTGTCGTAGCCTCCGGTGCTTATCAATTTTCCGGTGCTCG
JMFF018H06+ TTCTAATTCCTCGAAAACCTTTGTCGTAGCCTCCGGTGCTTATCAATTTTCCGGTGCTCG
JMFF007M20+ TTCTAATTCCTCGAAAACCTTTGTCGTAGCCTCCGGTGCTTATCAATTTTCCGGTGCTCG
                      ____________________________________________________________
consensus TTCTAATTCCTCGAAAACCTTTGTCGTAGCCTCCGGTGCTTATCAATTTTCCGGTGCTCG
 
. : . : . : . : . : . :
JMFN016M08+ CTTGAGTGTCTTGACAACTTTAG
JMFF041I21+ CTTGAGTGTCTTGACAACTTTAG
JMFS033A04+ CTTGAGTGTCTTGACAACTTTAG
JMFS059G07+ CTTGAGTGTCTTGACAACTTTAG
JMFF040L04+ ACAGCCCTCCCGACGAGCACCATGTATTCAGGCTCAACTTGAGTGTCTTGACAACTTTAG
JMFF018H06+ ACAGCCCTCCCGACGAGCACCATGTATTCAGGCTCAACTTGAGTGTCTTGACAACTTTAG
JMFF007M20+ ACAGCCCTCCCGACGAGCACCATGTATTCAGGCTCAACTTGAGTGTCTTGACAACTTTAG
                      ____________________________________________________________
consensus ACAGCCCTCCCGACGAGCACCATGTATTCAGGCTCAACTTGAGTGTCTTGACAACTTTAG
 
. : . : . : . : . : . :
JMFN016M08+ CGGTGTCGAGATCATAGGTAACGCCATGAGCCCA--AGTCTTCACGGCCCTTATCATCTT
JMFF041I21+ CGGTGTCGGGATCATAGGTAACGCCATGAGCCCAGCAGTCATCACGGCCCTTTTCATCTT
JMFS033A04+ CGGTGTCGGGATCATAGGTAACGCCATGAGCCCAGCAGTCATCACGGCCCTTTTCATCTT
JMFS059G07+ CGGTGTCGGGATCATAGGTAACGCCATGAGCCCAGCAGTCATCACGGCCCTTTTCATCTT
JMFF040L04+ CGGTGTCGAGATCATAGGTAACGCCATGAGCCCAGCAGTCTTCACGGCCCTTATCATCTT
JMFF018H06+ CGGTGTCGAGATCATAGGTAACGCCNTGAGCCCAGCAGTCTTCACGGCCCTTATCATCTT
JMFF028L06+ TTATCATCTT
JMFF007M20+ CGGTGTCGAGATCATAGGTAACGCCATGAGCCCAGCAGTCTTCACGGCCCTTATCATCTT
                      ____________________________________________________________
consensus CGGTGTCGAGATCATAGGTAACGCCATGAGCCCAGCAGTCTTCACGGCCCTTATCATCTT
 
. : . : . : . : . : . :
JMFN016M08+ TTCTGCACCACTTAGGATTCTGCATCAGTGCGGAGCGACCAAGATTAATGGCGTCATACC
JMFF041I21+ TTCTGCACCACTTAGGATTCTGCATCAGTGCGGAGCGACCAAGATTAATGGCGTCAAACC
JMFS033A04+ TTCTGCACCACTTAGGATTCTGCATCAGTGCGGAGCGACCAAGATTAATGGCGTCAAACC
JMFS059G07+ TTCTGCACCACTTAGGATTCTGCATCAGTGCGGAGCGACCAAGATTAATGGCGTCAAACC
JMFF040L04+ TTCTGCACCACTTAGGATTCTGCATCAGTGCGGAGCGACCAAGATTAATGGCGTCATACC
JMFF018H06+ TTCTGCACCACTTAGGATTCTGCATCAGTGCGGAGCGACCAAGATTAATGGCGTCATACC
JMFF028L06+ TTCTGCACCACTTAGGATTCTGCATCAGTGCGGAGCGACCAAGATTAATGGCGTCATACC
JMFF007M20+ TTCTGCACCACTTAGGATTCTGCATCAGTGCGGAGCGACCAAGATTAATGGCGTCATACC
                      ____________________________________________________________
consensus TTCTGCACCACTTAGGATTCTGCATCAGTGCGGAGCGACCAAGATTAATGGCGTCATACC
 
. : . : . : . : . : . :
JMFN016M08+ AGACAACCCTGTTGTTTGTCATCAACTGCATGTGCATGGCGGAAACACCCACGTTTTCAG
JMFF041I21+ AGACAACCTTGTTGTTTGTCATCAACTGCATGTGCATGGCGGAAACACCCACGTTTTCAG
JMFS033A04+ AGACAACCTTGTTGTTTGTCATCAACTGCATGTGCATGGCGGAAACACCCACGTTTTCAG
JMFS059G07+ AGACAACCTTGTTGTTTGTCATCAACTGCATGTGCATGGCGGAAACACCCACGTTTTCAG
JMFF040L04+ AGACAACCCTGTTGTTTGTCATCAACTGCATGTGCAAGGCGGAAACACCCACGTTTTCAG
JMFF018H06+ AGACAACCCTGTTGTTTGTCATCAACTGCATGTGCATGGCGGAAACACCCACGTTTTCAG
JMFF028L06+ AGACAACCCTGTTGTTTGTCATCAACTGCATGTGCATGGCGGAAACACCCACGTTTTCAG
JMFF007M20+ AGACAACCCTGTTGTTTGTCATCAACTGCATGTGCATGGCGGAAACACCCACGTTTTCAG
                      ____________________________________________________________
consensus AGACAACCCTGTTGTTTGTCATCAACTGCATGTGCATGGCGGAAACACCCACGTTTTCAG
 
. : . : . : . : . : . :
JMFN016M08+ TTACAGTTTGCCAGCTCGAGGCTGAAGGATTCATCTCCAAATCTGGTTTCCCATAGGCGC
JMFF041I21+ TTACAGTTTGCCAGCTCGAGGCCGAAGGATTCATCTCCAAATCTGGTTTCCCATAGGCGC
JMFS033A04+ TTACAGTTTGCCAGCTCGAGGCCGAAGGATTCATCTCCAAATCTGGTTTCCCATAGGCGC
JMFS059G07+ TTACAGTTTGCCAGCTCGAGGCCGAAGGATTCATCTCCAAATCTGGTTTCCCATAGGCGC
JMFF040L04+ TTACAGTTTGCCAGCTCGAGGCTAAAGGATTCATCTCCAAATCTGGTTTCCCATAGGCGC
JMFF018H06+ TTACAGTTTGCCAGCTCGAGGCTGAAGGATTCATCTCCAAATCTGGTTTCCCATAGGCGC
JMFF028L06+ TTACAGTTTGCCAGCTCGAGGCTGAAGGATTCATCCCCAAATNTGGTTTCCCATAGGCGC
JMFF007M20+ TTACAGTTTGCCAGCTCGAGGCTGAAGGATTCATCTCCAAATCTGGTTTCCCATAGGCGC
                      ____________________________________________________________
consensus TTACAGTTTGCCAGCTCGAGGCTGAAGGATTCATCTCCAAATCTGGTTTCCCATAGGCGC
 
. : . : . : . : . : . :
JMFN016M08+ TGCAAACAAACAATACAAGAACATAATAATAAGCTACTGTTA---------TTGACGCCA
JMFF041I21+ TGCAAACAAACAATACAAGAACATAATAATAAGCTACTGTTA---------TTGA
JMFS033A04+ TGCAAACAAACAATACAAGAACATAATAATAAGCTACTGTTATTGATATTTTTGACGCCA
JMFS059G07+ TGCAAACAAACAATACAAGAACATAATAATAAGCTACTGTTA---------TTGA
JMFF040L04+ TGCAAACAAACAATACAAGAACATAATAATAAGCTACTGTTA---------TTGACGCCA
JMFF018H06+ TGCAAACAAACAATACAAGAACATAATAATAAGCTACTGTTA---------TTGACGCCA
JMFF028L06+ TGCAAACAAACAATACAAGAACATAATAATAAGCTACTGTTA---------TTGACGCCA
JMFF007M20+ TGCAAACAAACAATACAAGAACATAATAATAAGCTACTGTTA---------TTGACGCCA
                      ____________________________________________________________
consensus TGCAAACAAACAATACAAGAACATAATAATAAGCTACTGTTA---------TTGACGCCA
 
. : . : . : . : . : . :
JMFN016M08+ TTGGAGAAACTCGATCTTTTATT--TATCTAGCTTCTCCAATGGACTAATTCTTTTTATT
JMFS033A04+ TTGGAGAAACTCGATCTTTTATT--TATCTAGCTTCTCCAATGGACTAAT
JMFF040L04+ TTGGAGAAACTCGATCTTTTATT--TATCTAGCTTCTCCAATGGACTAATTCTTTTTATT
JMFF018H06+ TTGGAGAAACACGATCTTTTATTTATATCTAGCTTCTCCAATGGACTAATTCTTTTTATT
JMFF028L06+ TTGGAGAAACACGATCTTTTATTTATATCTAGCTTCTCCAATGGACTAATTCTTTTTATT
JMFF007M20+ TTGGAGAAACACGATCTTTTATTTATATCTAGCTTCTCCAATGGACTAATTCTTTTTATT
                      ____________________________________________________________
consensus TTGGAGAAACTCGATCTTTTATTTATATCTAGCTTCTCCAATGGACTAATTCTTTTTATT
 
. : . : . : . : . : . :
JMFF040L04+ TATTTCTCGATGTTCGATGTTC
JMFF018H06+ TATTTCTCGATGTTCGATGTTC
JMFF028L06+ TATTTCTCGATGTTCGATGTTC
JMFF007M20+ TATTCCTCGATGTTCGATGTTCGATGTTCGATGTTCGATGTTCGATGTTCGATGTTCGAT
                      ____________________________________________________________
consensus TATTTCTCGATGTTCGATGTTCGATGTTCGATGTTCGATGTTCGATGTTCGATGTTCGAT