Previous Contig 000399:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007M19Sequence484000399 (4)pir|C96761|C967611e-32hypothetical protein T9L24.35 [imported] - Arabidopsis thaliana>gb:AE005173_8948714009555 (2)gb:AY086278_15713311e-13Arabidopsis thaliana clone 23293 mRNA, complete sequence.
JMFF028J11Sequence554000399 (4)pir|C96761|C967611e-37hypothetical protein T9L24.35 [imported] - Arabidopsis thaliana>gb:AE005173_8948717009555 (2)gb:AY080848_15685403e-16Arabidopsis thaliana unknown protein (At1g73460) mRNA, partial cds.
JMFS028G06Sequence676000399 (4)gb:AC147426_17446701e-61Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence.
JMFS147G09Sequence624000399 (4)gb:AC147426_17446703e-56Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS028G06+ GCAGCCAAGCCATCATGATCAGCTCTCCTGTATATTTCAGTTACTGACAACNCCAT
                      ____________________________________________________________
consensus GCAGCCAAGCCATCATGATCAGCTCTCCTGTATATTTCAGTTACTGACAACNCCAT
 
. : . : . : . : . : . :
JMFS028G06+ GGGATCATCTGCAGGCCCAACTCCATCAACAGCTTTTGACTTGATATACTGCTCCCCTGA
JMFS147G09+ CCTGA
                      ____________________________________________________________
consensus GGGATCATCTGCAGGCCCAACTCCATCAACAGCTTTTGACTTGATATACTGCTCCCCTGA
 
. : . : . : . : . : . :
JMFS028G06+ AAAGTAAGAATCTTCTTCTGCAAAAGATTGGTCATCTTCTTCTCTGTTTTGACTTCTTTG
JMFS147G09+ AAAGTAAGAGTCTTCTTCTGCAAATGATTGGTCATCTTCTTCTCTGTTTTGACTTCTTTG
                      ____________________________________________________________
consensus AAAGTAAGAGTCTTCTTCTGCAAATGATTGGTCATCTTCTTCTCTGTTTTGACTTCTTTG
 
. : . : . : . : . : . :
JMFS028G06+ AGGGTCAGGTACACTCCCATGTCCTGTTCCCTTCTCAGTGTCACTTGGGTAATCAATTTC
JMFS147G09+ AGGGTCAGGTACACTCCCATGTCCCGTTCCCTTCTCAGTATCACTTGGATAATCAATTTC
                      ____________________________________________________________
consensus AGGGTCAGGTACACTCCCATGTCCTGTTCCCTTCTCAGTGTCACTTGGGTAATCAATTTC
 
. : . : . : . : . : . :
JMFS028G06+ ATGAGACAAAAACCAGGTCTCATCTTCAATAGGTTGCCTAGTGTAGCCTACATCATCATC
JMFS147G09+ ATGAGACAAAAACCAGGTCTCATCTTCAATAGGTTGCCTAGTGTAGCCTACATCATCATC
JMFF028J11+ CCTACATCATCATC
                      ____________________________________________________________
consensus ATGAGACAAAAACCAGGTCTCATCTTCAATAGGTTGCCTAGTGTAGCCTACATCATCATC
 
. : . : . : . : . : . :
JMFS028G06+ ATCGTCATATTCATCAGAGTCCCAATATTCAGTTGGATAGTCAACAGGTTCACTAAGTCC
JMFS147G09+ ATCATCATATTCATCAGAGTCCCAATATTCAGTTGGATAGTCAACTGGTTCACTAAGTCC
JMFF028J11+ ATCATCATATTCATCAGAGTCCCAATATTCAGTTGGATAGTCAACTGGTTCACTAAGTCC
JMFF007M19+ GTCC
                      ____________________________________________________________
consensus ATCATCATATTCATCAGAGTCCCAATATTCAGTTGGATAGTCAACTGGTTCACTAAGTCC
 
. : . : . : . : . : . :
JMFS028G06+ ACCAATAGTTGCGAAACCAGAAATAAGATCAGAAGTGTCCCCAGCAATTCCCTGACTCAC
JMFS147G09+ ACCAATAGTTGCAAAACCAGAAACAAGATCAGAAGTGTCCCCAACAATGCCCTGACTCAC
JMFF028J11+ ACCAATAGTTGCAAAACCAGAAACAAGATCAGAAGTGTCCCCAACAATGCCCTGACTCAC
JMFF007M19+ ACCAATAGTTGCAAAACCAGAAACAAGATCAGAAGTGTCCCCAACAATGCCCTGACTCAC
                      ____________________________________________________________
consensus ACCAATAGTTGCAAAACCAGAAACAAGATCAGAAGTGTCCCCAACAATGCCCTGACTCAC
 
. : . : . : . : . : . :
JMFS028G06+ AGAGAACAAACTACCTTCCACAGGCCTTTTTCCACCTGAAGGGTTAATTTCTTGTCCTAC
JMFS147G09+ AGAGAGCAAACTACCTCCCACAAATCTTTTGCCACCTGAAGGGTTAATTTCTTGTCCTAC
JMFF028J11+ AGAGAGCAAACTACCTCCCACAAATCTTTTGCCACCTGAAGGGTTAATTTCTTGTCCTAC
JMFF007M19+ AGAGAGCAAACTACCTCCCACAAATCTTTTGCCACCTGAAGGGTTAATTTCTTGTCCTAC
                      ____________________________________________________________
consensus AGAGAGCAAACTACCTCCCACAAATCTTTTGCCACCTGAAGGGTTAATTTCTTGTCCTAC
 
. : . : . : . : . : . :
JMFS028G06+ AGGAACATCCAGAAATGACCCTATAGGATAGCCTTTATCAGTATTAGAAATACTTAAGTC
JMFS147G09+ AGGAACATCCAGAAATGACCCAATAAGATAGGTTTGATCAGTACTAGAAATACTCAAGTC
JMFF028J11+ AGGAACATCCAGAAATGACCCAATAAGATAGGTTTGATCAGTACTAGAAATACTCAAGTC
JMFF007M19+ AGGAACATCCAGAAATGACCCAATAAGATAGGTTTGATCAGTACTAGAAATACTCAAGTC
                      ____________________________________________________________
consensus AGGAACATCCAGAAATGACCCAATAAGATAGGTTTGATCAGTACTAGAAATACTCAAGTC
 
. : . : . : . : . : . :
JMFS028G06+ ATTTGAATCTCGTTCAAACTTTTCTACCCAATGAATATCAAATAGCTTCTCTTCTGATTT
JMFS147G09+ ATTTCCATCTCGTTCAAACTTTTCTACCCAATGAATATTAAACGGCTTCTCTTCTGATTT
JMFF028J11+ ATTTCCATCTCGTTCAAACTTTTCTACCCAATGAATATTAAACGGCTTCTCTTCTGATTT
JMFF007M19+ ATTTCCATCTCGTTCAAACTTTTCTACCCAATGAATATTAAACGGCTTCTCTTCTGATTT
                      ____________________________________________________________
consensus ATTTCCATCTCGTTCAAACTTTTCTACCCAATGAATATTAAACGGCTTCTCTTCTGATTT
 
. : . : . : . : . : . :
JMFS028G06+ GAGTCTAACAGGTGGTAATCTGGGTAGCTCTTCCTTTTGGTTCTCTGATCCAAGTGGAAG
JMFS147G09+ GAGTCTAACAGGTGGTAATCTAGGTAGCTCTTCCGTTTGGTTCTCTGATCCAAGTGGAAG
JMFF028J11+ GAGTCTAACAGGTGGTAATCTAGGTAGCTCTTCCGTTTGGTTCTCTGATCCAAGTGGAAG
JMFF007M19+ GAGTCTAACAGGTGGTAATCTAGGTAGCTCTTCCGTTTGGTTCTCTGATCCAAGTGGAAG
                      ____________________________________________________________
consensus GAGTCTAACAGGTGGTAATCTAGGTAGCTCTTCCGTTTGGTTCTCTGATCCAAGTGGAAG
 
. : . : . : . : . : . :
JMFS028G06+ GC
JMFS147G09+ GCTAAAGCCAGAAAGATCCTTTGGCTCACTTCCATGTGCTCTCACAAAGTACAAAGCTCT
JMFF028J11+ GCTAAAGCCAGAAAGATCCTTTGGCTCACTTCCATGTGCTCTCACAAAGTACAAAGCTCT
JMFF007M19+ GCTAAAGCCAGAAAGATCCTTTGGCTCACTTCCATGTGCTCTCACAAAGTACAAAGCTCT
                      ____________________________________________________________
consensus GCTAAAGCCAGAAAGATCCTTTGGCTCACTTCCATGTGCTCTCACAAAGTACAAAGCTCT
 
. : . : . : . : . : . :
JMFS147G09+ TCCAATTTCATCCACTTGC
JMFF028J11+ TCCAATTTCATCCACTTGCTCTTTGATAGCTGCCTTAATGTCAGTAATCTCTGGTTTTCT
JMFF007M19+ TCCAATTTCATCCACTTGCTCTTTGATAGCTGCCTTAATGTCAGTAATCTCTGGTTTTCT
                      ____________________________________________________________
consensus TCCAATTTCATCCACTTGCTCTTTGATAGCTGCCTTAATGTCAGTAATCTCTGGTTTTCT
 
. : . : . : . : . : . :
JMFF028J11+ CTTCTCTTCATTTTTATCACCAATTACAATTTTATGATCATAACTCGTTGATACATCTTC
JMFF007M19+ CTTCTCTTCATTTTTATCACCAATTACAATTTTATGATCATAACTCGTTGATACATCTTC
                      ____________________________________________________________
consensus CTTCTCTTCATTTTTATCACCAATTACAATTTTATGATCATAACTCGTTGATACATCTTC