Previous Contig 000398:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007M13Sequence374000398 (3)gb:HSU63332_20253715e-12Human super cysteine rich protein mRNA, partial cds.746020804gb:AY054261_15630812e-68Arabidopsis thaliana AT3g19540/T31J18_4 mRNA, complete cds.>gb:AY133526_1581349
JMFF042G07Sequence646000398 (3)gb:HSU63332_20253711e-11Human super cysteine rich protein mRNA, partial cds.
JMFS115G02Sequence569000398 (3)gb:HSU63332_20253718e-12Human super cysteine rich protein mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042G07+ GACTTCCCGATCTCGAGATCAACGTGTCGGGATTCACAACAAAATGACCG
                      ____________________________________________________________
consensus GACTTCCCGATCTCGAGATCAACGTGTCGGGATTCACAACAAAATGACCG
 
. : . : . : . : . : . :
JMFS115G02+ CTTCCTCCATAGCAGCCTAGAGAGAGGCGACCCGCTT
JMFF042G07+ CTGCTGCTACCACCACTACTCTTCTTCCTCCATAGCAGCCTAGAGAGAGGCGACCCGCTT
                      ____________________________________________________________
consensus CTGCTGCTACCACCACTACTCTTCTTCCTCCATAGCAGCCTAGAGAGAGGCGACCCGCTT
 
. : . : . : . : . : . :
JMFS115G02+ CTCGCCGGACTCTTCGCCCTTGATCGCGCCGGCGATAAGCTCCTAACCACTTCTTCCTTT
JMFF042G07+ CTCGCCGGACTCTTCGCCCTTGATCGCGCCGGCGATAAGCTCCTAACCACTTCTTCCTTT
                      ____________________________________________________________
consensus CTCGCCGGACTCTTCGCCCTTGATCGCGCCGGCGATAAGCTCCTAACCACTTCTTCCTTT
 
. : . : . : . : . : . :
JMFS115G02+ AACGCCGAGAAGAACCCTTGCTTCCGCTCCATTTCCCAAACCACCCTAACTCTCTCTCCT
JMFF042G07+ AACGCCGAGAAGAACCCTTGCTTCCGCTCCATTTCCCAAACCACCCTAACTCTCTCTCCT
                      ____________________________________________________________
consensus AACGCCGAGAAGAACCCTTGCTTCCGCTCCATTTCCCAAACCACCCTAACTCTCTCTCCT
 
. : . : . : . : . : . :
JMFS115G02+ TCTCTCTCTCTAACCAAATCAATATAAACACATAACGCTACTACGCTACCTCAGACACAC
JMFF042G07+ TCTCTCTCTCTAACCAAATCAATATAAACACATAACGCTACTACGCTACCTCAGACACAC
JMFF007M13+ TACCTCAGACACAC
                      ____________________________________________________________
consensus TCTCTCTCTCTAACCAAATCAATATAAACACATAACGCTACTACGCTACCTCAGACACAC
 
. : . : . : . : . : . :
JMFS115G02+ CGAACAAGAATGCGACTAAAGGCCTGCCATGGCCGGAACCATAACCTCGCACTAAAAGCT
JMFF042G07+ CGAACAAGAATGCGACTAAAGGCCTGCCATGGCCGGAACCATAACCTCGCACTAAAAGCT
JMFF007M13+ CGAACAAGAATGCGACTAAAGGCCTGCCATGGCCGGAACCATAACCTCGCACTAAAAGCT
                      ____________________________________________________________
consensus CGAACAAGAATGCGACTAAAGGCCTGCCATGGCCGGAACCATAACCTCGCACTAAAAGCT
 
. : . : . : . : . : . :
JMFS115G02+ AAACCCACTCAAAAACAAACCCAGAACCGGAACTAAAATCTGGGTTCACTCGATTCCAAT
JMFF042G07+ AAACCCACTCAAAAACAAACCCAGAACCGGAACTAAAATCTGGGTTCACTCGATTCCAAT
JMFF007M13+ AAACCCACTCAAAAACAAACCCAGAACCGGAACTAAAATCTGGGTTCACTCGATTCCAAT
                      ____________________________________________________________
consensus AAACCCACTCAAAAACAAACCCAGAACCGGAACTAAAATCTGGGTTCACTCGATTCCAAT
 
. : . : . : . : . : . :
JMFS115G02+ GCCACTGCGATTATCAACAGAGAACAGAGACCCCAATACACGAATAATGCCCCTACACAA
JMFF042G07+ GCCACTGCGATTATCAACAGAGAACAGAGACCCCAATACACGAATAATGCCCCTACACAA
JMFF007M13+ GCCACTGCGATTATCAACAGAGAACAGAGACCCCAATACACGAATAATGCCCCTACACAA
                      ____________________________________________________________
consensus GCCACTGCGATTATCAACAGAGAACAGAGACCCCAATACACGAATAATGCCCCTACACAA
 
. : . : . : . : . : . :
JMFS115G02+ CAACAACAACACTGTTCTCTCAGCAAAGAAACCTCTGCAAGCGCGAAAGACTGGAAGAAA
JMFF042G07+ CAACAACAACACTGTTCTCTCAGCAAAGAAACCTCTGCAAGCGCGAAAGACTGGAAGAAA
JMFF007M13+ CAACAACAACACTGTTCTCTCAGCAAAGAAACCTCTGCAAGCGCGAAAGACTGGAAGAAA
                      ____________________________________________________________
consensus CAACAACAACACTGTTCTCTCAGCAAAGAAACCTCTGCAAGCGCGAAAGACTGGAAGAAA
 
. : . : . : . : . : . :
JMFS115G02+ GAGAAAGAAGATGAAGAAAGAAATTTCCAGTAGAGTGGTGTCAGCTGCTACTTTGCGAGC
JMFF042G07+ GAGAAAGAAGATGAAGAAAGAAATTTCCAGTAGAGTGGTGTCAGCTGCTACTTTGCGAGC
JMFF007M13+ GAGAAAGAAGATGAAGAAAGAAATTTCCAGTAGAGTGGTGTCAGCTGCTACTTTGCGAGC
                      ____________________________________________________________
consensus GAGAAAGAAGATGAAGAAAGAAATTTCCAGTAGAGTGGTGTCAGCTGCTACTTTGCGAGC
 
. : . : . : . : . : . :
JMFS115G02+ GAGAGAGAGAGAGAGAGTGAAAGAAAAGGAGGAGAGAGAGAGGATAGTGTGG
JMFF042G07+ GAGAGAGAGAGAGAGAGTGAAAGAAAAGGAGGAGAGAGAGAGGATAGTGTGG
JMFF007M13+ GAGAGAGAGAGAGAGAGTGAAAGAAAAGGAGGAGAGAGAGAGGATAGTGTGGTGCCCCCT
                      ____________________________________________________________
consensus GAGAGAGAGAGAGAGAGTGAAAGAAAAGGAGGAGAGAGAGAGGATAGTGTGGTGCCCCCT