Previous Contig 000397:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007M11Sequence536000397 (2)gb:AF394544_17954727e-51Oryza sativa alpha-expansin OsEXPA2 (EXPA2) gene, complete cds.>gb:AP003230_1825
JMFN043H02Sequence621000397 (2)gb:AF230332_1779031e-100Zinnia elegans expansin 2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN043H02+ CTTTTGGAATTAAAATTGAGCCCCTTCAAAAGTCTGGCCAAAATGCCAATTTGCA
                      ____________________________________________________________
consensus CTTTTGGAATTAAAATTGAGCCCCTTCAAAAGTCTGGCCAAAATGCCAATTTGCA
 
. : . : . : . : . : . :
JMFN043H02+ GGGGCGGCATTGTTGCTGATGACGGTCCTCCCGTCGCCCGTGGTGACTTGGAATGAGAGG
                      ____________________________________________________________
consensus GGGGCGGCATTGTTGCTGATGACGGTCCTCCCGTCGCCCGTGGTGACTTGGAATGAGAGG
 
. : . : . : . : . : . :
JMFN043H02+ CTTTGGCCATCCAGAACGGAGTTGCTTTGCCAATTTTGGCCCCAATTCCGTGACATTTGT
                      ____________________________________________________________
consensus CTTTGGCCATCCAGAACGGAGTTGCTTTGCCAATTTTGGCCCCAATTCCGTGACATTTGT
 
. : . : . : . : . : . :
JMFN043H02+ TGCCACCCGGTTTTTGACCCCTTGATCGCAACAGCATGGACATCCCCAGAACCCCCAACG
                      ____________________________________________________________
consensus TGCCACCCGGTTTTTGACCCCTTGATCGCAACAGCATGGACATCCCCAGAACCCCCAACG
 
. : . : . : . : . : . :
JMFN043H02+ TTAGTCACCAACACCAAGTTAAAATAGGTGTGTCCGTTGATCGTGAATCTTATTCCTCCC
                      ____________________________________________________________
consensus TTAGTCACCAACACCAAGTTAAAATAGGTGTGTCCGTTGATCGTGAATCTTATTCCTCCC
 
. : . : . : . : . : . :
JMFN043H02+ TTCTTTCTACAAGGCACCCTTCGGTAAGATACAGGGACAATTCCAGCCCGGTAAATAGCG
JMFF007M11+ CAAGGCACCCTTCGGTAATTTACGGGCACAATTCCAGCACGATAAACGCCA
                      ____________________________________________________________
consensus TTCTTTCTACAAGGCACCCTTCGGTAATTTACGGGGACAATTCCAGCCCGGTAAATGGCG
 
. : . : . : . : . : . :
JMFN043H02+ ATTTGCAAGTAGGCAGGCTGGGCCATGTCGAAGTGCTGGCGGGGAGAGTTGCACCAGCCA
JMFF007M11+ ATTTGTAAGTAGGCAGGCTCGGCCATGTCGAAGTGTGGGCGGGGAGGGTTGCACCAGCCG
                      ____________________________________________________________
consensus ATTTGTAAGTAGGCAGGCTGGGCCATGTCGAAGTGTTGGCGGGGAGGGTTGCACCAGCCG
 
. : . : . : . : . : . :
JMFN043H02+ CCATTGTCGTTGGAGAGGCCGGGGTTGGGCGGGCAGAAGTCGGTGGCGGTGATGGTGATG
JMFF007M11+ CCGTTGTCATTGGGCAAGCCGGGGTTGGGCGGGCAAAAGTCGGTGGCGGTGATGGTGACG
                      ____________________________________________________________
consensus CCGTTGTCGTTGGGGAGGCCGGGGTTGGGCGGGCAGAAGTCGGTGGCGGTGATGGTGATG
 
. : . : . : . : . : . :
JMFN043H02+ CTGCCGGGGACGCAGTAGGGGCCGTTGCACATAAGCTCGTAGCAAGAGCCGCAGGCCA-A
JMFF007M11+ GAGCCAGGGAGGCAGTAGGGGCCGGTGCACATGAGCTCGTAGCATGAACCGCAAGCCAGG
                      ____________________________________________________________
consensus GTGCCGGGGAGGCAGTAGGGGCCGTTGCACATGAGCTCGTAGCATGAGCCGCAGGCCAGG
 
. : . : . : . : . : . :
JMFN043H02+ GCCATTATTGAACAGAGCAGTGCTAAGAGCTGCAATGTTGGTGCCATAACCTGTGCTGTA
JMFF007M11+ GCCATTGTTGAAGAGGGCAGTGCTTAGTGCTGCAATGTTGGTGCCATAGCCTGTCCTATA
                      ____________________________________________________________
consensus GCCATTGTTGAAGAGGGCAGTGCTTAGTGCTGCAATGTTGGTGCCATAGCCTGTGCTGTA
 
. : . : . : . : . : . :
JMFN043H02+ CAAGTTACCATATCCACAAGCCCCCCC
JMFF007M11+ CAAGTTGCCATATCCGCAAGCTCCCCCCATTGTGCCAGAAGCATCAGAACCACCATAGAA
                      ____________________________________________________________
consensus CAAGTTGCCATATCCGCAAGCTCCCCCCATTGTGCCAGAAGCATCAGAACCACCATAGAA
 
. : . : . : . : . : . :
JMFF007M11+ AGTAGCATGAGCAGTTTGCCATCCTCCATAGTCACCAAAAGCTAGATGAACACAAAAGCT
                      ____________________________________________________________
consensus AGTAGCATGAGCAGTTTGCCATCCTCCATAGTCACCAAAAGCTAGATGAACACAAAAGCT
 
. : . : . : . : . : . :
JMFF007M11+ TGAGAAGAAGAGTAGGAGAAAGGGGATTGAGAATGTTGATGGAACAGCCATTTAAGAAGA
                      ____________________________________________________________
consensus TGAGAAGAAGAGTAGGAGAAAGGGGATTGAGAATGTTGATGGAACAGCCATTTAAGAAGA
 
. : . : . : . : . : . :
JMFF007M11+ GAAAGAAATAAAGAGAGAAGATGAGTGATATGAATTTGTGGGGAGTGAGCTAGCTTACTT
                      ____________________________________________________________
consensus GAAAGAAATAAAGAGAGAAGATGAGTGATATGAATTTGTGGGGAGTGAGCTAGCTTACTT