Previous Contig 000396:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006H24Sequence548000396 (11)gb:AE005172_8897336e-38Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153902559000396 (11)
JMFF007M10Sequence624000396 (11)gb:AE005172_8897333e-40Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153902739000396 (11)
JMSF012I11Sequence480000396 (11)gb:AE005172_8897331e-38Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153902777000396 (11)gb:AE005172_8897338e-05Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153902
JMSF021J19Sequence379000396 (11)gb:AP003279_18271251e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P052760000396 (11)
JMSF026F19Sequence712000396 (11)gb:AP003279_18271251e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P052709000396 (11)
JMSF049A11Sequence481000396 (11)gb:AE005172_8897332e-36Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153902627013754 (5)gb:AP003633_18318331e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P063

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF007M10- ATAAATAAGGTGAACAAAGTGTATACTAGATGCCAGTATGACACAACTGTCTA
rJMSF026F19- AAGTGTATACTAGATGCCAGTATGACACAACTGTCTA
rJMSF021J19- AAGTGTATACTAGATGCCAGTATGACACAACTGTCTA
                      ____________________________________________________________
consensus ATAAATAAGGTGAACAAAGTGTATACTAGATGCCAGTATGACACAACTGTCTA
 
. : . : . : . : . : . :
rJMFF007M10- TCGTCGTGTAGTCCTGCAGCTAATGTCTAAGTAGTAAAACAAAACCAGAAAGAGCAATGA
rJMSF026F19- TCGTCGTGTAGTCCTGCAGCTAATGTCTAAGTAGTAAAACAAAACCAGAAAGAGCAATGA
rJMSF021J19- TCGTCGTGTAGTCCTGCAGCTAATGTCTAAGTAGTAAAACAAAACCAGAAAGAGCAATGA
                      ____________________________________________________________
consensus TCGTCGTGTAGTCCTGCAGCTAATGTCTAAGTAGTAAAACAAAACCAGAAAGAGCAATGA
 
. : . : . : . : . : . :
rJMFF007M10- GTATATGGAACATTTATTCCCAAAAGGGGAGGAGCGATTGATAAGCTCACATTAAACAAC
rJMSF026F19- GTATATGGAACATTTATTCCCAAAAGGGGAGGAGCGATTGATAAGCTCACATTAAACAAC
rJMSF021J19- GTATATGGAACATTTATTCCCAAAAGGGGAGGAGCGATTGATAAGCTCACATTAAACAAC
                      ____________________________________________________________
consensus GTATATGGAACATTTATTCCCAAAAGGGGAGGAGCGATTGATAAGCTCACATTAAACAAC
 
. : . : . : . : . : . :
rJMFF007M10- CCAGATGATCATATAAGCCGAAAAGAGTTAAGACAAGCAAGTTATATATACATATTCACG
rJMSF026F19- CCAGATGATCATATAAGCCGAAAAGAGTTAAGACAAGCAAGTTATATATACATATTCACG
rJMSF021J19- CCAGATGATCATATAAGCCGAAAAGAGTTAAGACAAGCAAGTTATATATACATATTCACG
rJMFF006H24- GACAAGCAAGTTATATATACATATTCACG
rJMSF012I11- AGACAAGCAAGTTATATATACATATTCACG
                      ____________________________________________________________
consensus CCAGATGATCATATAAGCCGAAAAGAGTTAAGACAAGCAAGTTATATATACATATTCACG
 
. : . : . : . : . : . :
rJMFF007M10- CAAATGGCCAAACCATAAAACAAACCATAGAGCATACCCAGTGAGGTATACCATACA-GT
rJMSF026F19- CAAATGGCCAAACCATAAAACAAACCATAGAGCATACCCAGTGAGGTATACCATACA-GT
rJMSF021J19- CAAATGGCCAAACCATAAAACAAACCATAGAGCATACCCAGTGAGGTATACCATACA-GT
rJMFF006H24- CAAATGGCCAAACCATAGNACAAACCATAGAGCATACCCAGTGAGGTATACCATACAGGT
rJMSF012I11- CAAATGGCCAAACCATAAAACAAACCATAGAGCATACCCAGTGAGGTATACCATACA-GT
                      ____________________________________________________________
consensus CAAATGGCCAAACCATAAAACAAACCATAGAGCATACCCAGTGAGGTATACCATACA-GT
 
. : . : . : . : . : . :
rJMFF007M10- AAGACCTTTTTGGCAGCAAGAATACTAGTAATCAACATGGTAGTCACTGTAATTATCCCT
rJMSF026F19- AAGACCTTTTTGGCAGCAAGAATACTAGTAATCAACATGGTAGTCACTGTAATTATCCCT
rJMSF021J19- AAGACCTTTTTGGCAGCAAGAATACTAGTAATCAACATGGTAGTCACTGTAATTATCCCT
rJMFF006H24- AAGACCTTTTTGGCAACANNAATACTAGTAATCAACATGGTAGTCACTGTAATTATCCCT
rJMSF012I11- AAGACCTTTTTGGCAGCAAGAATACTAGTAATCAACATGGTAGTCACTGTAATTATCCCT
                      ____________________________________________________________
consensus AAGACCTTTTTGGCAGCAAGAATACTAGTAATCAACATGGTAGTCACTGTAATTATCCCT
 
. : . : . : . : . : . :
rJMFF007M10- TCCAGAAATGTCACGCTCAACTCTCTCTGCAATCTTCTCTTCCTCATATTTCAAACCCTC
rJMSF026F19- TCCAGAAATGTCACGCTCAACTCTCTCTGCAATCTTCTCTTCCTCATATTTCAAACCCTC
rJMSF021J19- TCCAGAAATGTCACGCTCAACTCTCTCTGCAATCTTCTCTTCCTCATATTTCAAACCCTC
rJMFF006H24- TCCATAAATGTCACGCTCAACTCTCTCTGCAATCTTCTCTTCCTCATATTTCAAACCCTC
rJMSF012I11- TCCAGAAATGTCACGCTCAACTCTCTCTGCAATCTTCTCTTCCTCATATTTCAAACCCTC
                      ____________________________________________________________
consensus TCCAGAAATGTCACGCTCAACTCTCTCTGCAATCTTCTCTTCCTCATATTTCAAACCCTC
 
. : . : . : . : . : . :
rJMFF007M10- CTCCAATGCCAGCCCTCCTAGGGCTCCTGCCACAGCTCCAACTGCCAATCCAGTTCCTAA
rJMSF026F19- CTCCAATGCCAGCCCTCCTAGGGCTCCTGCCACAGCTCCAACTGCCAATCCAGTTCCTAA
rJMSF021J19- CTCCAATGCCAGCCCTCCTAGGGCTCCTGCCACAGCTCCAACTGCCAATCCAGTTCCTAA
rJMFF006H24- CTCCAATGCCANCCCTCCTANGGCTCCTGCCACNGCTCCANCTGCCAATCCAGTTCCTAA
rJMSF012I11- CTCCAATGCCAGCCCTCCTAGGGCTCCTGCCACAGCTCCAACTGCCAATCCAGTTCCTAA
                      ____________________________________________________________
consensus CTCCAATGCCAGCCCTCCTAGGGCTCCTGCCACAGCTCCAACTGCCAATCCAGTTCCTAA
 
. : . : . : . : . : . :
rJMFF007M10- TCCCATCTTTCCACTACGCTTGTTATCATACGGTGCATAATCCAACCGGCGCACTAGGCC
rJMSF026F19- TCCCATCTTTCCACTACGCTTGTTATCATACGGTGCATAATCC-ACCGGCGCACTAGGCC
rJMSF021J19- TCCCATCTTTCCACTACGCTTGTTATCATACGGTGCATAATCC-ACCGGCGCACTAGGCC
rJMFF006H24- TCCCATCTTTCCACTACNCTTGTTATCATACGGNGCATAATCC-ACCGGCGCACTANGCC
rJMSF012I11- TCCCATCTTTCCACTACGCTTGTTATCATACGGTGCATAATCC-ACCGGCGCACTAGGCC
                      ____________________________________________________________
consensus TCCCATCTTTCCACTACGCTTGTTATCATACGGTGCATAATCC-ACCGGCGCACTAGGCC
 
. : . : . : . : . : . :
rJMFF007M10- CCGGCCTGCCAAAGCTGGGTTGTCGGTCAGGGAACGGCCGTGGCGGATAAGGAGGCTGAG
rJMSF026F19- CCGGCCTGCCAAAGCTGGGTTGTCGGTCAGGGAACGGCCGTGGCGGATAAGGAGGCTGAG
rJMSF021J19- CCGGCCTGCCAAAGCTGGGTTGTCGGTCAGGGAACGGCCGTGGCGGATAAGGAGGCTGAG
rJMFF006H24- CCGGCCTGCCANAGCTGGGTTGTCGGTCAGGGAACGGCCGTGGCNGATAANGAGGCTGAN
rJMSF012I11- CCGGCCTGCCAAAGCTGGGTTGTCGGTCAGGGAACGGCCGTGGCGGATAAGGAGGCTGAG
JMSF026F19+ CTGAG
                      ____________________________________________________________
consensus CCGGCCTGCCAAAGCTGGGTTGTCGGTCAGGGAACGGCCGTGGCGGATAAGGAGGCTGAG
 
. : . : . : . : . : . :
rJMFF007M10- CGTAGTAACCGGGGTAGTAGCTAGAGTATGGATCAGAGTATCCGCCGTATTGATAAGGAT
rJMSF026F19- CGTAGTAACCGGGGTAGTAGCTAGAGTATGGATCAGAGTATCCGCCGTATTGATAAGGAT
rJMSF021J19- CGTAGTAACCGGGGTAGTAGCTAGAGTATGGATCAGAGTATCCGCCGTATTGATAAGGAT
rJMFF006H24- CGTAATAACCGGGGTAGTAGCTAGAGTATGGATCAGAGTATCCGCCGTATTGATAACGAT
rJMSF012I11- CGTAGTAACCGGGGTAGTAGCTAGAGTATGGATCAGAGTATCCGCCGTATTGATAAGGAT
JMSF026F19+ CGTAGTAACC-GGGTAGTAGCTAGAGTATGGATCAGAGTATCCGCCGTATTGATAAGGAT
                      ____________________________________________________________
consensus CGTAGTAACCGGGGTAGTAGCTAGAGTATGGATCAGAGTATCCGCCGTATTGATAAGGAT
 
. : . : . : . : . : . :
rJMFF007M10- GCGAGTGGGGGANGGAAGGTGGAGGTGATAAAGTCGGATGAGGCGGCGGCACCAGCGCGG
rJMSF026F19- GCGAGTGGGG---AGGAGGTGGAGGTGATAGAGTCGGATGAGGCGGCGGCACCAGCGCGG
rJMSF021J19- GCGAGTGGGG---AGGAGGTGGAGGTGATAGAGTCGGATGAGGCGGCGGCACCAGCGCGG
rJMFF006H24- GCNANTGGGG---AGGAGGTGGAGGNGANAGAGTCGGATGANGNGGCGGNACCAGCGCGG
rJMSF012I11- GCGAGTGGGG---AGGAGGTGGAGGTGATAGAGTCGGATGAGGCGGCGGCACCAGCGCGG
JMSF026F19+ GCGAGTGGGG---AGGAGGTGGAGGTGATAGAGTCGGATGAGGCGGCGGCACCAGCGCGG
JMFF007M10+ GATGAGGCGGCGGCACCAGCGCGG
                      ____________________________________________________________
consensus GCGAGTGGGG---AGGAGGTGGAGGTGATAGAGTCGGATGAGGCGGCGGCACCAGCGCGG
 
. : . : . : . : . : . :
rJMFF007M10- GAGATGGGGGCTGGTGTGGGTTGTACG
rJMSF026F19- GAGATGGGGGCTGGTGT
rJMSF021J19- GAGATGGGGGCTGGTGTGGGTTGTACGGAGGGATATTGTATCCTCGGTAATCACGGGAAG
rJMFF006H24- GAGATGGGGGCTGNTGTGGGTTGTACGGAGGGATATTGTATCCTCNGTAATCAC
rJMSF012I11- GAGATGGGGGCTGGTGTGGGTTGTACGGAGGGATATTGTATCCTCGGTAATCACGGGAAG
JMSF026F19+ GAGATGGGGGCTGGTGTGGGTTGTACGGAGGGATATTGTATCCTCGGTAATCACGGGAAG
JMFF006H24+ TCGGTAATCACGGGAAG
JMFF007M10+ GAGATGGGGGCTGGTGTGGGTTGTACGGAGGGATATTGTATCCTCGGTAATCACGGGAAG
                      ____________________________________________________________
consensus GAGATGGGGGCTGGTGTGGGTTGTACGGAGGGATATTGTATCCTCGGTAATCACGGGAAG
 
. : . : . : . : . : . :
rJMSF021J19- CGGG
rJMSF012I11- CGGGCGGCGGCGGCGCAGTTGAGAAATAATAGCTGGACGGAGGGGGAATTTGGAAATCAG
JMSF049A11+ GGAAATCAG
JMSF026F19+ CGGGCGGCGGCGG-GCAGTTGAGAAATAATAGCTGGACGGATGGGGAATTTGGAAATCAG
JMFF006H24+ CGGGCGGCGGCGGCGCAGTTGAGAAATAATAGCTGGACGGAGGGGGAATTTGGAAATCAG
JMFF007M10+ CGGGCGGCGGCGGCGCAGTTGAGAAATAATAGCTGGACGGAGGGGGAATTTGGAAATCAG
                      ____________________________________________________________
consensus CGGGCGGCGGCGGCGCAGTTGAGAAATAATAGCTGGACGGAGGGGGAATTTGGAAATCAG
 
. : . : . : . : . : . :
rJMSF012I11- GGGGGCTCGGGCGTTCCTGGATAGAGATTTTGAGTCGGATCTTACCCTGGGGGCGACCGG
JMSF049A11+ GGGGGCTCGGGCGTTCCTGGATAGAGATTNTGAGTCGGATCTTACCCTGGGGGCGACCGG
JMSF026F19+ GGGGGCTCGGGCGTTCCTGGATAGAGATTTTGAGTCGGATCTTACCCTGGGGGCGACCGG
JMFF006H24+ GGGGGCTCGGGCGTTCCTGGATAGAGATTTTGAGTCGGATCTTACCCTGGGGGCGACCGG
JMSF012I11+ GGGGGCTCGGGCGTTCCTGGATAGAGATTTTGAGTCGGATCTTACCCTGGGGGCGACCGG
JMFF007M10+ GGGGGCTCGGGCGTTCCTGGATAGAGATTTTGAGTCGGATCTTACCCTGGGGGCGACCGG
                      ____________________________________________________________
consensus GGGGGCTCGGGCGTTCCTGGATAGAGATTTTGAGTCGGATCTTACCCTGGGGGCGACCGG
 
. : . : . : . : . : . :
rJMSF012I11- AGGGTANAAGGAGCTCGAAACTTCTGACCTTCGTGGAATCATCCGAGCACATCACGTCCT
JMSF049A11+ AGGGTAGAAGGAGCTCGAAACTTCTGACCTTCGTGGAATCATCCGAGCACATCACGTCCT
JMSF026F19+ AGGGTAGAAGGAGCTCGAAACTTCTGACCTTCGTGGAATCATCCGAGCACATCACGTCCT
JMFF006H24+ AGGGTAGAAGGAGCTCGAAACTTCTGACCTTCGTGGAATCATCCGAGCACATCACGTCCT
JMSF021J19+ TGGAATCATCCGAGCACATCACGTCCT
JMSF012I11+ AGGGTAGAAGGAGCTCGAAACTTCTGACCTTCGTGGAATCATCCGAGCACATCACGTCCT
JMFF007M10+ AGGGTAGAAGGAGCTCGAAACTTCTGACCTTCGTGGAATCATCCGAGCACATCACGTCCT
                      ____________________________________________________________
consensus AGGGTAGAAGGAGCTCGAAACTTCTGACCTTCGTGGAATCATCCGAGCACATCACGTCCT
 
. : . : . : . : . : . :
rJMSF012I11- TGAGCGGCAACCTTAGGG
JMSF049A11+ TGAGCGGCAACCTTAGGGTTCCGACCAACGGCTTGGGCGTCTCCGACGGCTTCGAGTGGA
JMSF026F19+ TGAGCGGCAACCTTAGGGTTCCGACCAACGGCTTGGGCGTCTCCGACGGCTTCGAGTGGA
JMFF006H24+ TGAGCGGCAACCTTAGGGTTCCGACCAACGGCTTGGGCGTCTCCGACGGCTTCGAGTGGA
JMSF021J19+ TGAGCGGCAACCTTAGGGTTCCGACCAACGGNTTGGGCGTCTCNGACGGCTTCGAGTGGA
JMSF012I11+ TGAGCGGCAACCTTAGGGTTCCGACCAACGGCTTGGGCGTCTCCGACGGCTTCGAGTGGA
JMFF007M10+ TGAGCGGCAACCTTAGGGTTCCGACCAACGGCTTGGGCGTCTCCGACGGCTTCGAGTGGA
                      ____________________________________________________________
consensus TGAGCGGCAACCTTAGGGTTCCGACCAACGGCTTGGGCGTCTCCGACGGCTTCGAGTGGA
 
. : . : . : . : . : . :
JMSF049A11+ AGATCTCGAGAGTGAGCAGCGATTCCTGAGGCGGGACCGCCAGAGGAAGCACGAACCGCT
JMSF026F19+ AGATCTCGAGAGTGAGCAGCGATTCCTGAGGCGGGACCGCCAGAGGAAGCACGAACCGCT
JMFF006H24+ AGATCTCGAGAGTGAGCAGCGATTCCTGAGGCGGGACCGCCAGAGGAAGCACGAACCGCT
JMSF021J19+ AGATCTCGAGAGTGAGCAGCGATTCCTGAGGCGGGACCNCCAGAGGAAGCACGAACCGCT
JMSF012I11+ AGATCTCGAGAGTGAGCAGCGATTCCTGAGGCGGGACCGCCAGAGGAAGCACGAACCGCT
JMFF007M10+ AGATCTCGAGAGTGAGCAGCGATTCCTGAGGCGGGACCGCCAGAGGAAGCACGAACCGCT
                      ____________________________________________________________
consensus AGATCTCGAGAGTGAGCAGCGATTCCTGAGGCGGGACCGCCAGAGGAAGCACGAACCGCT
 
. : . : . : . : . : . :
JMSF049A11+ CNTTCCACACCGGNTTGGTCGATCCATGATCGTCCGATTTGGTAGCGAGACGACGATCGG
JMSF026F19+ CGTTCCACACCGGCTTGGTCGATCCATGATCGTCCGATTTGGTAGCGAGACGACGATCGG
JMFF006H24+ CGTTCCACACCGGCTTGGTCGATCCATGATCGTCCGATTTGGTAGCGAGACGACGATCGG
JMSF021J19+ NGTTCCACACCGGCTTGGTCGATCCATGATCGTCCGATTTGGTAGCGAGACGACGATCGG
JMSF012I11+ CGTTCCACACCGGCTTGGTCGATCCATGATCGTCCGATTTGGTAGCGAGACGACGATCGG
JMFF007M10+ CGTTCCACACCGGCTTGGTCGATCCATGATCGTCCGATTTGGTAGCGAGACGACGATCGG
                      ____________________________________________________________
consensus CGTTCCACACCGGCTTGGTCGATCCATGATCGTCCGATTTGGTAGCGAGACGACGATCGG
 
. : . : . : . : . : . :
JMSF049A11+ GATCCACCCAGAAGATCACATAGGGCTTGAGATCCCCGTGGCGCCAATTCACNTTCTTCA
JMSF026F19+ GATCCACCCAGAAGATCACATAGGGCTTGAGATCCCCGTGGCGCCAATTCACGTTCTTCA
JMFF006H24+ GATCCACCCAGAAGATCACATAGGGCTTGAGATCCCCGTGGCGCCAATTCACGTTCTTCA
JMSF021J19+ GATCCACCCAGAAGATCACATAGGGCTTGAGATCCCCGTGGCGCCAATTCACGTTCTTCA
JMSF012I11+ GATCCACCCAGAAGATCACATAGGGCTTGAGATCCCCGTGGCGCCAATTCACGTTCTTCA
JMFF007M10+ GATCCACCCAGAAGATCACATAGGGCTTGAGATCCCCGTGGCGCCAATTCACGTTCTTCA
                      ____________________________________________________________
consensus GATCCACCCAGAAGATCACATAGGGCTTGAGATCCCCGTGGCGCCAATTCACGTTCTTCA
 
. : . : . : . : . : . :
JMSF049A11+ GATGCTTGGCGGAGACGATTGTGAAGTCGACATCGTACGGCTTCGAAGGCGGCAGAGAGC
JMSF026F19+ GATGCTTGGCGGAGACGATTGTGAAGTCGACATCGTACGGCTTCGAAGGCGGCAGAGAGC
JMFF006H24+ GATGCTTGGCGGAGACGATTGTGAAGTCGACATCGTACGGCTTCGAAGGCGGCAGAGAGC
JMSF021J19+ GATGCTTGGCGGAGACGATTGTGAAGTCGACATCGTACGGCTTCGAAGGCGGCAGAGAGC
JMSF012I11+ GATGCTTGGCGGAGACGATTGTGAAGTCGACATCGTACGGCTTCGAAGGCGGCAGAGAGC
JMFF007M10+ GATGCTTGGCGGAGACGATTGTGAAGTCGACATCGTACGGCTTCGAAGGCGGCAGAGAGC
                      ____________________________________________________________
consensus GATGCTTGGCGGAGACGATTGTGAAGTCGACATCGTACGGCTTCGAAGGCGGCAGAGAGC
 
. : . : . : . : . : . :
JMSF049A11+ TCGCTGCTGCCATGGCGATTATCGTCCGAGGTACAGAAAGATGAGATTTACC
JMSF026F19+ TCGCTGCTGCCATGGCGATTATCGTCCGAGGTACAGAAAGATGAGATTTACC
JMFF006H24+ TCGCTGCTGCCATGGCGATTATCGTCCGAGGTACAGAAAGATGAGATTTAC
JMSF021J19+ TCGNTGNTGCCATGGCGATTATCGTCCGAGGTACAGAAAGATGAGATTTACC
JMSF012I11+ TCGCTGCTGCCATGGCGATTATCGTCCGAGGTACAGAAAGATGAGATTTACC
JMFF007M10+ TCGCTGCTGCCATGGCGATTATCGTCCGAGGTACAGAAAGATGAGATTTACAGAGAAAAC
                      ____________________________________________________________
consensus TCGCTGCTGCCATGGCGATTATCGTCCGAGGTACAGAAAGATGAGATTTACCGAGAAAAC