Previous Contig 000395:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007M05Sequence571000395 (4)pir|T49082|T490825e-31hypothetical protein F4F15.140 - Arabidopsis thaliana>gb:ATF4F15_1550669 Arabido734008513 (2)pir|T49082|T490821e-38hypothetical protein F4F15.140 - Arabidopsis thaliana>gb:ATF4F15_1550669 Arabido
JMFN013I22Sequence627000395 (4)pir|T49082|T490821e-50hypothetical protein F4F15.140 - Arabidopsis thaliana>gb:ATF4F15_1550669 Arabido
JMFS036C01Sequence606000395 (4)pir|T49082|T490821e-39hypothetical protein F4F15.140 - Arabidopsis thaliana>gb:ATF4F15_1550669 Arabido
JMSF006G08Sequence390000395 (4)pir|T49082|T490826e-09hypothetical protein F4F15.140 - Arabidopsis thaliana>gb:ATF4F15_1550669 Arabido430008513 (2)pir|T49082|T490825e-09hypothetical protein F4F15.140 - Arabidopsis thaliana>gb:ATF4F15_1550669 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN013I22+ CCCATCCTCACATCCAATCACAGCTTCTGGATCAACATAACGCATACAGAGTCCCTTTGG
JMFS036C01+ GTCCCTTTGG
                      ____________________________________________________________
consensus CCCATCCTCACATCCAATCACAGCTTCTGGATCAACATAACGCATACAGAGTCCCTTTGG
 
. : . : . : . : . : . :
JMFN013I22+ GAACAAGGCATCACGTGAGGATAGTATACTTCTTGTTTCAGTCCGACTCCATATACATAT
JMFS036C01+ GAACAAGGCATCACGTGAGGATAGTATACTTCTTGTTTCAGTCCGACTCCATATACATAT
                      ____________________________________________________________
consensus GAACAAGGCATCACGTGAGGATAGTATACTTCTTGTTTCAGTCCGACTCCATATACATAT
 
. : . : . : . : . : . :
JMFN013I22+ CCGGGTACCAACCAAACCAACAACCTTGCTCTCATCAAAATCAAAATCAATTAGAGGGGC
JMFS036C01+ CCGGGTACCAACCAAACCAACAACCTTGCTCTCATCAAAATCAAAATCAATTAGAGGGGC
JMFF007M05+ TCTCATCAAAATCAAAATCAATTAGAGGGGC
                      ____________________________________________________________
consensus CCGGGTACCAACCAAACCAACAACCTTGCTCTCATCAAAATCAAAATCAATTAGAGGGGC
 
. : . : . : . : . : . :
JMFN013I22+ TTTATCAGGGAGAACGTATTCATCCAAGCATTTGTAGCTTTCTGCTGACCAGAGTCGCAT
JMFS036C01+ TTTATCAGGGAGAACGTATTCATCCAAGCATTTGTAGCTTTCTGCTGACCAGAGTCGCAT
JMFF007M05+ TTTATCAGGGAGAACGTATTCATCCAAGCATTTGTAGCTTTCTGCTGACCAGAGTCGCAT
                      ____________________________________________________________
consensus TTTATCAGGGAGAACGTATTCATCCAAGCATTTGTAGCTTTCTGCTGACCAGAGTCGCAT
 
. : . : . : . : . : . :
JMFN013I22+ GACCTTATCACCCACACCAGTAAGAAAATGTCCCATCTTCATCCGGCACTGATTAACCCC
JMFS036C01+ GACCTTATCACCCACACCAGTAAGAAAATGTCCCATCTTCATCCGGCACTGATTAACCCC
JMSF006G08+ CACTGATTAACCCC
JMFF007M05+ GACCTTATCACCCACACCAGTAAGAAAATGTCCCATCTTCATCCGGCACTGATTAACCCC
                      ____________________________________________________________
consensus GACCTTATCACCCACACCAGTAAGAAAATGTCCCATCTTCATCCGGCACTGATTAACCCC
 
. : . : . : . : . : . :
JMFN013I22+ GACTGAATGGCCTCTCCACTGGAAAACTTTGGCAGGACCATCCACTAAGGCAAACCTGTG
JMFS036C01+ GACTGAATGGCCTCTCCACTGGAAAACTTTGGCAGGACCATCCACTAAGGCAAACCTGTG
JMSF006G08+ GACTGAATGGCCTCTCCACTGGAAAACTTTGGCAGGACCATCCACTAAGGCAAACCTGTG
JMFF007M05+ GACTGAATGGCCTCTCCACTGGAAAACTTTGGCAGGACCATCCACTAAGGCAAACCTGTG
                      ____________________________________________________________
consensus GACTGAATGGCCTCTCCACTGGAAAACTTTGGCAGGACCATCCACTAAGGCAAACCTGTG
 
. : . : . : . : . : . :
JMFN013I22+ TGTTAGCATAGCTAACCGCTCCAAATGTTCACTAAATGATCCTGTAGGTAAAGATATCTG
JMFS036C01+ TGTTAGCATAGCTAACCGCTCCAAATGTTCACTAAATGATCCTGTAGGTAAAGATATCTG
JMSF006G08+ TGTTAGCATAGCTAACCGCTCCAAATGTTCACTAAATGATCCTGTAGGTAAAGATATCTG
JMFF007M05+ TGTTAGCATAGCTAACCGCTCCAAATGTTCACTAAATGATCCTGTAGGTAAAGATATCTG
                      ____________________________________________________________
consensus TGTTAGCATAGCTAACCGCTCCAAATGTTCACTAAATGATCCTGTAGGTAAAGATATCTG
 
. : . : . : . : . : . :
JMFN013I22+ ACTGTTGTCATCAGGATCATTTTTCTGTTGCTGCTGATACCGTCTGTGAATGACTTTTCT
JMFS036C01+ ACTGTTGTCATCAGGATCATTTTTCTGTTGCTGCTGATACCGTCTGTGAATGACTTTTCT
JMSF006G08+ ACTGTTGTCATCAGGATCATTTTTCTGTTGCTGCTGATACCGTCTGTGAATGACTTTTCT
JMFF007M05+ ACTGTTGTCATCAGGATCATTTTTCTGTTGCTGCTGATACCGTCTGTGAATGACTTTTCT
                      ____________________________________________________________
consensus ACTGTTGTCATCAGGATCATTTTTCTGTTGCTGCTGATACCGTCTGTGAATGACTTTTCT
 
. : . : . : . : . : . :
JMFN013I22+ CCAAGATGAGCAGACGACAGAGCAGCGAATAACCTCGGCGAGATCGAGGAAGGCAAAAAT
JMFS036C01+ CCAAGATGAGCAGACGACAGAGCAGCGAATAACCTCGGCGAGATCGAGGAAGGCAAAAAT
JMSF006G08+ CCAAGATGAGCAGACGACAGAGCAGCGAATAACCTCGGCGAGATCGAGGAAGGCAAAAAT
JMFF007M05+ CCAAGATGAGCAGACGACAGAGCAGCGAATAACCTCGGCGAGATCGAGGAAGGCAAAAAT
                      ____________________________________________________________
consensus CCAAGATGAGCAGACGACAGAGCAGCGAATAACCTCGGCGAGATCGAGGAAGGCAAAAAT
 
. : . : . : . : . : . :
JMFN013I22+ AATTCCGAGGGAGTCATCGCTGAGGTCTTGAATTCTCGTCCTCCTAGCTTTCTTCGGCGG
JMFS036C01+ AATTCCGAGGGAGTCATCGCTGAGGTCTTGAATTCTCGTCCTCCTAGCTTTCTTCGGCGG
JMSF006G08+ AATTCCGAGGGAGTCATCGCTGAGGTCTTGAATTCTCGTCCTCCTAGCTTTCTTCGGCGG
JMFF007M05+ AATTCCGAGGGAGTCATCGCTGAGGTCTTGAATTCTCGTCCTCCTAGCTTTCTTCGGCGG
                      ____________________________________________________________
consensus AATTCCGAGGGAGTCATCGCTGAGGTCTTGAATTCTCGTCCTCCTAGCTTTCTTCGGCGG
 
. : . : . : . : . : . :
JMFN013I22+ ACGCCGGAGGCCCGCCGCCGATGGCTC
JMFS036C01+ ACGCCGGAGGCCCGCCGCCGATGGCTCCATAATATCGACCGGGTCGGCTCAGGACT
JMSF006G08+ ACGCCGGAGGCCCGCCGCCGATGGCTCCATAATATCGACCGGGTCGGCTCAGGACTTCAG
JMFF007M05+ ACGCCGGAGGCCCGCCGCCGATGGCTCCATAATATCGACCGGGTCGGCTCAGGACTTCAG
                      ____________________________________________________________
consensus ACGCCGGAGGCCCGCCGCCGATGGCTCCATAATATCGACCGGGTCGGCTCAGGACTTCAG
 
. : . : . : . : . : . :
JMSF006G08+ GGTAGAAGAGA
JMFF007M05+ GGTAGAAGAGAAGTCTCGACTTCGAACCGCGGTGTCACTATTTAATAGCATATGAATTGT
                      ____________________________________________________________
consensus GGTAGAAGAGAAGTCTCGACTTCGAACCGCGGTGTCACTATTTAATAGCATATGAATTGT