Previous Contig 000394:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007M04Sequence603000394 (4)sp|Q9FM65|FLA1_ARATH7e-50Fasciclin-like arabinogalactan protein 1 precursor.>gb:AB009050_1510634 Arabidop617009643 (4)sp|Q9FM65|FLA1_ARATH2e-29Fasciclin-like arabinogalactan protein 1 precursor.>gb:AB009050_1510634 Arabidop
JMFF007M15Sequence416000394 (4)sp|Q9FM65|FLA1_ARATH4e-28Fasciclin-like arabinogalactan protein 1 precursor.>gb:AB009050_1510634 Arabidop
JMFF022B17Sequence546000394 (4)sp|Q9FM65|FLA1_ARATH2e-45Fasciclin-like arabinogalactan protein 1 precursor.>gb:AB009050_1510634 Arabidop751009643 (4)sp|Q9FM65|FLA1_ARATH1e-49Fasciclin-like arabinogalactan protein 1 precursor.>gb:AB009050_1510634 Arabidop
JMFF030M08Sequence416000394 (4)sp|Q9FM65|FLA1_ARATH3e-28Fasciclin-like arabinogalactan protein 1 precursor.>gb:AB009050_1510634 Arabidop692009643 (4)sp|Q9FM65|FLA1_ARATH1e-42Fasciclin-like arabinogalactan protein 1 precursor.>gb:AB009050_1510634 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007M04+ CCGC
                      ____________________________________________________________
consensus CCGC
 
. : . : . : . : . : . :
JMFF022B17+ CTCCTC
JMFF007M04+ TTGCGGCGACGGCAAGATACGACTGATCTGGAGAACGGAAATGTTGTAGGGTATCTCCTC
                      ____________________________________________________________
consensus TTGCGGCGACGGCAAGATACGACTGATCTGGAGAACGGAAATGTTGTAGGGTATCTCCTC
 
. : . : . : . : . : . :
JMFF022B17+ GATAGACTTGACGTAAGTGGCCGGCAGGGATCCGCCGTTGTCCTCAGGCCCAAATCCGAC
JMFF007M04+ GATAGACTTGACGTAAGTGGCCGGCAGGGATCCGCCGTTGTCCTCAGGCCCAAATCCGAC
                      ____________________________________________________________
consensus GATAGACTTGACGTAAGTGGCCGGCAGGGATCCGCCGTTGTCCTCAGGCCCAAATCCGAC
 
. : . : . : . : . : . :
JMFF022B17+ TTTTCCGCCCTTCAGATCCGTGATATTGACAAAGCCGGTGGAGCCGGACGCCGAGCCGGA
JMFF007M04+ TTTTCCGCCCTT-AGATCCGTGATATTGACAAAGCCGGTGGAGCCGGACGCCGAGCCGGA
                      ____________________________________________________________
consensus TTTTCCGCCCTTCAGATCCGTGATATTGACAAAGCCGGTGGAGCCGGACGCCGAGCCGGA
 
. : . : . : . : . : . :
JMFF030M08+ TGGAACATAGTAGCGGCCAAAGCCGTACCATTGGAGATTTGGTGGAGCTTCTTGGT
JMFF022B17+ GGCCTGGAACATAGTAGCGGCCAAAGCCGTACCATTGGAGATTTGGTGGAGCTTCTTGGT
JMFF007M15+ TGGAACATAGTAGCGGCCAAAGCCGTACCATTGGAGATCTGGTGGAGCTTCTTGGT
JMFF007M04+ GGCCTGGAACATAGTAGCGGCCAAAGCCGTACCATTGGAGATTTGGTGGAGCTTCTTGGT
                      ____________________________________________________________
consensus GGCCTGGAACATAGTAGCGGCCAAAGCCGTACCATTGGAGATTTGGTGGAGCTTCTTGGT
 
. : . : . : . : . : . :
JMFF030M08+ GTCGTAGTAGTCCAGAAGGACGTGAAGGGAGAGCACATTCTTAATGGTGTTAATGGACAG
JMFF022B17+ GTCGTAGTAGTCCAGAAGGACGTGAAGGGAGAGCACATTCTTAATGGTGTTAATGGACAG
JMFF007M15+ GTNGTAGTAGTCCAGAAGGACGTGAAGGGAGAGCACATTCTTAATGGTGTTAATGGACAG
JMFF007M04+ GTCGTAGTAGTCCAGAAGGACGTGAAGGGAGAGCACATTCTTAATGGTGTTAATGGACAG
                      ____________________________________________________________
consensus GTCGTAGTAGTCCAGAAGGACGTGAAGGGAGAGCACATTCTTAATGGTGTTAATGGACAG
 
. : . : . : . : . : . :
JMFF030M08+ GTGCTTGGCGAGCAGATCCGCCATGGCCGCCTCGTCGACGGCGCAGACGGTTATGGTCTC
JMFF022B17+ GTGCTTGGCGAGCAGATCCGCCATGGCCGCCTCGTCGACGGCGCAGACGGTTATGGTCTC
JMFF007M15+ GTGCTTGGCGAGCAGATCCGCCATGGCCGCCTCGTCGACGGCGCAGACGGTTATGGTCTC
JMFF007M04+ GTGCTTGGCGAGCAGATCCGCCATGGCCGCCTCGTCGACGGCGCAGACGGTTATGGTCTC
                      ____________________________________________________________
consensus GTGCTTGGCGAGCAGATCCGCCATGGCCGCCTCGTCGACGGCGCAGACGGTTATGGTCTC
 
. : . : . : . : . : . :
JMFF030M08+ GCGGTTGTTGATATCGGCGGCGAGGTGTGTCAGTGTCAGGTAGTGATTAAAGGTAGCAAA
JMFF022B17+ GCGGTTGTTGATATCGGCGGCGAGGTGTGTCAGTGTCAGGTAGTGATTAAAGGTAGCAAA
JMFF007M15+ GCGGTTGTTGATATCGGCGGCGAGGTGTGTCAGTGTCAGGTAGTGATTAAAGGTAGCAAA
JMFF007M04+ GCGGTTGTTGATATCGGCGGCGAGGTGTGTCAGTGTCAGGTAGTGATTAAAGGTAGCAAA
                      ____________________________________________________________
consensus GCGGTTGTTGATATCGGCGGCGAGGTGTGTCAGTGTCAGGTAGTGATTAAAGGTAGCAAA
 
. : . : . : . : . : . :
JMFF030M08+ CGCTTTATCCTTGGCCAGAATGCGGGTGATATTGTGGGCTCCGGCGCCTTCCGGCCAAAG
JMFF022B17+ CGCTTTATCCTTGGCCAGAATGCGGGTGATATTGTGGGCTCCGGCGCCTTCCGGCCAAAG
JMFF007M15+ CGCTTTATCCTTGGCCAGAATGCGGGTGATATTGTGGGCTACGGCGCCTTCCGGCCAAAG
JMFF007M04+ CGCTTTATCCTTGGCCAGAATGCGGGTGATATTGTGGGCTACGGCGCCTTCCGGCCAAAG
                      ____________________________________________________________
consensus CGCTTTATCCTTGGCCAGAATGCGGGTGATATTGTGGGCTCCGGCGCCTTCCGGCCAAAG
 
. : . : . : . : . : . :
JMFF030M08+ CAACACTGTAAAACAGAGAAACGCCGCAACCACGGCGGCCGTTGAGAGGCTCTGCATTTT
JMFF022B17+ CAACACTGTAAAACAGAGAAACGCCGCAACCACGGCGGCCGTTGAGAGGCTCTGCATTTT
JMFF007M15+ CAACACTGTAAAACAGAGAAACGCCGCAACCACGGCGGCCGTTGAGAGGCTCTGCATTTT
JMFF007M04+ CAACACTGTAAAACAGAGAAACGCCGCAACCACGGCGGCCGTTGAGAGGCTCTGCATTTT
                      ____________________________________________________________
consensus CAACACTGTAAAACAGAGAAACGCCGCAACCACGGCGGCCGTTGAGAGGCTCTGCATTTT
 
. : . : . : . : . : . :
JMFF030M08+ CAGTTTGAAGGGAGGCGAGAGTTGCGATGATGGTTTTAGCTTTTCAGTTGCTTTGGAAGT
JMFF022B17+ CAGTTTGAAGGGAGGCGAGAGTTGCGATGATGGTTTTAGCTTTTCAGTTGCTTTGGAAGT
JMFF007M15+ CAGTTTGAAGGGAGGCGAGAGTTGCGATGATGGTTTTAGCTTTTCAGTTGCTTTGGAAGT
JMFF007M04+ CAGTTTGAAGGGAGGCGAGAGTTGCGATGATGGTTTTAGCTTTTCAGTTGCTTTGGAAGT
                      ____________________________________________________________
consensus CAGTTTGAAGGGAGGCGAGAGTTGCGATGATGGTTTTAGCTTTTCAGTTGCTTTGGAAGT