Previous Contig 000386:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007K19Sequence529000386 (14)gb:BT000451_16347293e-49Arabidopsis thaliana beta-ureidopropionase (At5g64370) mRNA, complete cds.>gb:BT712000386 (14)gb:BT000451_16347291e-93Arabidopsis thaliana beta-ureidopropionase (At5g64370) mRNA, complete cds.>gb:BT
JMFN006N14Sequence616000386 (14)gb:BT000451_16347292e-79Arabidopsis thaliana beta-ureidopropionase (At5g64370) mRNA, complete cds.>gb:BT
JMFN032I20Sequence627000386 (14)gb:BT000451_16347297e-76Arabidopsis thaliana beta-ureidopropionase (At5g64370) mRNA, complete cds.>gb:BT
JMSF017I06Sequence567000386 (14)gb:BT000451_16347293e-63Arabidopsis thaliana beta-ureidopropionase (At5g64370) mRNA, complete cds.>gb:BT802000386 (14)gb:BT000451_1634729e-100Arabidopsis thaliana beta-ureidopropionase (At5g64370) mRNA, complete cds.>gb:BT
JMSF022N13Sequence685000386 (14)gb:BT000451_16347292e-83Arabidopsis thaliana beta-ureidopropionase (At5g64370) mRNA, complete cds.>gb:BT167000386 (14)
JMSF032E06Sequence678000386 (14)gb:AF275345_17825223e-74Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro772000386 (14)gb:AJ843987_18146794e-80Plantago major mRNA for hypothetical protein.
JMSF040E16Sequence661000386 (14)gb:BT000451_16347292e-78Arabidopsis thaliana beta-ureidopropionase (At5g64370) mRNA, complete cds.>gb:BT834000386 (14)gb:BT000451_1634729e-111Arabidopsis thaliana beta-ureidopropionase (At5g64370) mRNA, complete cds.>gb:BT
JMSF040P23Sequence692000386 (14)gb:AJ843987_18146798e-83Plantago major mRNA for hypothetical protein.850000386 (14)gb:AJ843987_18146795e-90Plantago major mRNA for hypothetical protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032E06- GA
                      ____________________________________________________________
consensus GA
 
. : . : . : . : . : . :
JMSF032E06- GAAACCATATCCTTAAATCAGAAAGTTTGTTGATAAGATGGTACTAAAGACAATTGATCT
JMSF040P23- ATCCTTAAATCAGAAAGTTTGTTGATAAGATGGTACTAAAGACAATTGATCT
rJMSF040P23+ ATCCTTAAATCAGAAAGTTTGTTGATAAGATGGTACTAAAGACAATTGATCT
                      ____________________________________________________________
consensus GAAACCATATCCTTAAATCAGAAAGTTTGTTGATAAGATGGTACTAAAGACAATTGATCT
 
. : . : . : . : . : . :
JMSF032E06- GATTAAGAATGAAATTCCTCTAAATGAGGAATCAGTGGTTATATCAGAGGCTGCCAAGAC
JMSF040P23- GATTAAGAATGAAATTCCTCTAAATGAGGAATCAGTGGTTATATCAGAGGCTGCCAAGAC
rJMSF032E06+ TAAATGAGGAATCAGTGGTTATATCAGAGGCTGCCAAGAC
rJMSF040P23+ GATTAAGAATGAAATTCCTCTAAATGAGGAATCAGTGGTTATATCAGAGGCTGCCAAGAC
                      ____________________________________________________________
consensus GATTAAGAATGAAATTCCTCTAAATGAGGAATCAGTGGTTATATCAGAGGCTGCCAAGAC
 
. : . : . : . : . : . :
JMSF032E06- TGGTCTAGTTCTTGTAGATATCATCAATGGCTTCTGCACTGTTGGAGCTGGAAATCTGGC
JMSF040P23- TGGTCTAGTTCTTGTAGATATCATCAATGGCTTCTGCACTGTTGGAGCTGGAAATCTGGC
rJMSF032E06+ TGGTCTAGTTCTTGTAGATATCATCAATGGCTTCTGCACTGTTGGAGCTGGAAATCTGGC
rJMSF040P23+ TGGTCTAGTTCTTGTAGATATCATCAATGGCTTCTGCACTGTTGGAGCTGGAAATCTGGC
                      ____________________________________________________________
consensus TGGTCTAGTTCTTGTAGATATCATCAATGGCTTCTGCACTGTTGGAGCTGGAAATCTGGC
 
. : . : . : . : . : . :
JMSF032E06- TCCAAGAGAACCCAACAGGCAGATTTCAGAAATGATTGATGAATCTGCTAGGCTGGCAAG
JMSF040P23- TCCAAGAGAACCCAACAGGCAGATTTCAGAAATGATTGATGAATCTGCTAGGCTGGCAAG
rJMSF032E06+ TCCAAGAGAACCCAACAGGCAGATTTCAGAAATGATTGATGAATCTGCTAGGCTGGCAAG
rJMSF040P23+ TCCAAGAGAACCCAACAGGCAGATTTCAGAAATGATTGATGAATCTGCTAGGCTGGCAAG
                      ____________________________________________________________
consensus TCCAAGAGAACCCAACAGGCAGATTTCAGAAATGATTGATGAATCTGCTAGGCTGGCAAG
 
. : . : . : . : . : . :
JMSF032E06- GTTGTTCTGTGAAAAGGGTTGGCCTGTTCTTGCCTTTCTTGATTCACACAGTCCTGACAA
JMSF040P23- GTTGTTCTGTGAAAAGGGTTGGCCTGTTCTTGCCTTTCTTGATTCACACAGTCCTGACAA
rJMSF032E06+ GTTGTTCTGTGAAAAGGGTTGGCCTGTTCTTGCCTTTCTTGATTCACACAGTCCTGACAA
rJMSF040P23+ GTTGTTCTGTGAAAAGGGTTGGCCTGTTCTTGCCTTTCTTGATTCACACAGTCCTGACAA
                      ____________________________________________________________
consensus GTTGTTCTGTGAAAAGGGTTGGCCTGTTCTTGCCTTTCTTGATTCACACAGTCCTGACAA
 
. : . : . : . : . : . :
JMSF032E06- GCTTGAACACCCTTATCCTCCTCACTGCATCTCTGGCTCTGATGGATCCAATCTTGTTCC
JMSF040P23- GCTTGAACACCCTTATCCTCCTCACTGCATCTCTGGCTCTGATGAATCCAATCTTGTTCC
rJMSF032E06+ GCTTGAACACCCTTATCCTCCTCACTGCATCTCTGGCTCTGATGGATCCAATCTTGTTCC
rJMSF040P23+ GCTTGAACACCCTTATCCTCCTCACTGCATCTCTGGCTCTGATGAATCCAATCTTGTTCC
                      ____________________________________________________________
consensus GCTTGAACACCCTTATCCTCCTCACTGCATCTCTGGCTCTGATGGATCCAATCTTGTTCC
 
. : . : . : . : . : . :
JMSF032E06- TGCTCTGAGATGGCTAGAGAATGAACCAAATGTGAGGATCAGGCACAAAGATTGCTATGA
JMSF040P23- TGCTCTGAGATGGCTAGAGAATGAACCAAATGTGAGGATCAGGCACAAAGATTGCTATGA
rJMSF032E06+ TGCTCTGAGATGGCTAGAGAATGAACCAAATGTGAGGATCAGGCACAAAGATTGCTATGA
rJMSF040P23+ TGCTCTGAGATGGCTAGAGAATGAACCAAATGTGAGGATCAGGCACAAAGATTGCTATGA
                      ____________________________________________________________
consensus TGCTCTGAGATGGCTAGAGAATGAACCAAATGTGAGGATCAGGCACAAAGATTGCTATGA
 
. : . : . : . : . : . :
JMSF032E06- TGGCTACATCGGATCAGCTGAGGAAGACGGCTCTAACGC--TTGTTGATTGGGTAAAAGA
JMSF040P23- TGGCTACATCGGATCAGCTGAGGAAGACGGCTCTAACGCTTTTGTTGATTGGGTAAAAGA
rJMSF032E06+ TGGCTACATCGGATCAGCTGAGGAAGACGGCTCTAACGC--TTGTTGATTGGGTAAAAGA
rJMSF040P23+ TGGCTACATCGGATCAGCTGAGGAAGACGGCTCTAACGCTTTTGTTGATTGGGTAAAAGA
                      ____________________________________________________________
consensus TGGCTACATCGGATCAGCTGAGGAAGACGGCTCTAACGCTTTTGTTGATTGGGTAAAAGA
 
. : . : . : . : . : . :
JMSF032E06- CAACAAGATTCAAGTTTTACTGGTGGTTGGAGTTTGCACAGACATTTGTGTTCTGGATTT
JMSF040P23- CAACAAGATTCAAGTTTTACTGGTGGTTGGAGTTTGCACAGACATTTGTGTTCTGGATTT
rJMSF032E06+ CAACAAGATTCAAGTTTTACTGGTGGTTGGAGTTTGCACAGACATTTGTGTTCTGGATTT
rJMSF040P23+ CAACAAGATTCAAGTTTTACTGGTGGTTGGAGTTTGCACAGACATTTGTGTTCTGGATTT
                      ____________________________________________________________
consensus CAACAAGATTCAAGTTTTACTGGTGGTTGGAGTTTGCACAGACATTTGTGTTCTGGATTT
 
. : . : . : . : . : . :
JMSF032E06- TGTTTGCTCAACCATATCGGCTAGAAACCGAGGTTTTCTTGATCCTTTGGAGGATGTTGT
JMSF040P23- TGTTTGCTCAACCATATCGGCTAGAAACCGAGGTTTTCTTGATCCTTTGGAGGATGTTGT
rJMSF032E06+ TGTTTGCTCAACCATATCGGCTAGAAACCGAGGTTTTCTTGATCCTTTGGAGGATGTTGT
rJMSF040P23+ TGTTTGCTCAACCATATCGGCTAGAAACCGAGGTTTTCTTGATCCTTTGGAGGATGTTGT
                      ____________________________________________________________
consensus TGTTTGCTCAACCATATCGGCTAGAAACCGAGGTTTTCTTGATCCTTTGGAGGATGTTGT
 
. : . : . : . : . : . :
JMSF032E06- TGTTTGCTCAAAGGGATGTGCCACTTTTGACTTCCCACCCTCCATGGCAAACAACACCAA
JMSF040P23- TGTTTGCTCAAAGGGATGTGCCACTTTTGACTTCCCACCCTCCATGGCAAACAACACCAA
rJMSF032E06+ TGTTTGCTCAAAGGGATGTGCCACTTTTGACTTCCCACCCTCCATGGCAAACAACACCAA
rJMSF040P23+ TGTTTGCTCAAAGGGATGTGCCACTTTTGACTTCCCACCCTCCATGGCAAACAACACCAA
                      ____________________________________________________________
consensus TGTTTGCTCAAAGGGATGTGCCACTTTTGACTTCCCACCCTCCATGGCAAACAACACCAA
 
. : . : . : . : . : . :
JMSF032E06- AGATATCATGCCTCATCC
JMSF040P23- AGATATCATGCCTCATCCCCAGGAGCTCATGCATCACAT
rJMSF032E06+ AGATATCATGCCTCATCCCCAGGAGCTCATGCATCACATGGGACTTTACATGGCCAAACA
rJMSF040P23+ AGATATCATGCCTCATCCCCAGGAGCTCATGCATCACATGGGACTTTACATGGCCAAACA
                      ____________________________________________________________
consensus AGATATCATGCCTCATCCCCAGGAGCTCATGCATCACATGGGACTTTACATGGCCAAACA
 
. : . : . : . : . : . :
rJMSF032E06+ AAGAGGAGCAAAGATAGCTAAAGATGTATCTATTTCTCAAGTTTGAACTAAAGATCATGT
rJMSF040P23+ AAGAGGAGCAAAGATAGCTAAAGATGTATCTATTTCTCAAGTTTGAACTAAAGATCATGT
                      ____________________________________________________________
consensus AAGAGGAGCAAAGATAGCTAAAGATGTATCTATTTCTCAAGTTTGAACTAAAGATCATGT
 
. : . : . : . : . : . :
rJMSF032E06+ GATCTAGGAAAAAGGGTTTTCTTTATTCAACCAAAGTACTGTAGTTTAATGTACTAGAAT
rJMSF040P23+ GATCTAGGAAAAAGGGTTTTCTTTATTCAACCAAAGTACTGTAGTTTAATGTACTAGAAT
rJMFF007K19- GTTTTCTTTATTCAACCAAAGTACTGTAGTTTAATGTACTAGAAT
rJMSF017I06- GTACTAGAAT
rJMSF040E16- GTACTAGAAT
                      ____________________________________________________________
consensus GATCTAGGAAAAAGGGTTTTCTTTATTCAACCAAAGTACTGTAGTTTAATGTACTAGAAT
 
. : . : . : . : . : . :
rJMSF032E06+ ACATTCTAGTAT
rJMSF040P23+ ACATTCTAGTAT
rJMFF007K19- ACATTCTAGTATGTATTTCATCCAAATAATGCAGAACAAACAGATAGTTCAATGGCCATT
rJMSF017I06- ACATTCTAGTATGTATTTCATCCAAATAATGCAGAACAAACAGATAGTTCAATGGCCATT
rJMSF040E16- ACATTCTAGTATGTATTTCATCCAAATAATGCAGAACAAACAGATAGTTCAATGGCCATT
                      ____________________________________________________________
consensus ACATTCTAGTATGTATTTCATCCAAATAATGCAGAACAAACAGATAGTTCAATGGCCATT
 
. : . : . : . : . : . :
rJMFF007K19- CTTTTCTTAGTTTCTAAGACCTGCCATGATAACTCAAGAGGCATTCTTATGTAACAAGGG
rJMSF017I06- CTTTTCTTAGTTTCTAAGACCTGCCATGATAACTCAAGAGGCATTCTTATGTAACAAGGG
rJMSF040E16- CTTTTCTTAGTTTCTAAGACCTGCCATGATAACTCAAGAGGCATTCTTATGTAACAAGGG
                      ____________________________________________________________
consensus CTTTTCTTAGTTTCTAAGACCTGCCATGATAACTCAAGAGGCATTCTTATGTAACAAGGG
 
. : . : . : . : . : . :
rJMFF007K19- ATCGGAGATGACTTGTGGCTCGAAATCTGGTTTTACATAGCGAGAAAGCAAGTCTGCATA
rJMSF017I06- ATCGGAGATGACTTGTGGCTCGAAATCTGGTTTTACATAGCGAGAAAGCAAGTCTGCATA
rJMSF040E16- ATCGGAGATGACTTGTGGCTCGAAATCTGGTTTTACATAGCGAGAAAGCAAGTCTGCATA
                      ____________________________________________________________
consensus ATCGGAGATGACTTGTGGCTCGAAATCTGGTTTTACATAGCGAGAAAGCAAGTCTGCATA
 
. : . : . : . : . : . :
rJMFF007K19- CATCTCGTATCGTGCAGTCATCCTGAATCCCCACTTGTCCTTGAGTTGTCTGCAGAGGTT
rJMSF017I06- CATCTCGTATCGTGCAGTCATCCTGAATCCCCACTTGTCCTTGAGTTGTCTGCAGAGGTT
rJMSF040E16- CATCTCGTATCGTGCAGTCATCCTGAATCCCCACTTGTCCTTGAGTTGTCTGCAGAGGTT
                      ____________________________________________________________
consensus CATCTCGTATCGTGCAGTCATCCTGAATCCCCACTTGTCCTTGAGTTGTCTGCAGAGGTT
 
. : . : . : . : . : . :
rJMFF007K19- AAGATCCATGTCTGATATGATCAACCCGTCTCTGTAACGGGATAAAGATGGCGTGCACGA
rJMSF017I06- AAGATCCATGTCTGATATGATCAACCCGTCTCTGTAACGGGATAAAGATGGCGTGCACGA
rJMSF040E16- AAGATCCATGTCTGATATGATCAACCCGTCTCTGTAACGGGATAAAGATGGCGTGCACGA
                      ____________________________________________________________
consensus AAGATCCATGTCTGATATGATCAACCCGTCTCTGTAACGGGATAAAGATGGCGTGCACGA
 
. : . : . : . : . : . :
rJMFF007K19- AGCATCTGGTGACGAGAAATGGCTGGAACCATAGAAATGCCCAAAATCCGTGTGCTCGGG
rJMSF017I06- AGCATCTGGTGACGAGAAATGGCTGGAACCATAGAAATGCCCAAAATCCGTGTGCTCGGG
rJMSF040E16- AGCATCTGGTGACGAGAAATGGCTGGAACCATAGAAATGCCCAAAATCCGTGTGCTCGGG
                      ____________________________________________________________
consensus AGCATCTGGTGACGAGAAATGGCTGGAACCATAGAAATGCCCAAAATCCGTGTGCTCGGG
 
. : . : . : . : . : . :
rJMFF007K19- CTTCCCATCTCCAGATGTGAATGCATTGGGGAAAACTTCGGTTCCAACTCGATTTATTGA
rJMSF017I06- CTTCCCATCTCCAGATGTGAATGCATTGGGGAAAACTTCGGTTCCAACTCGATTTATTGA
rJMSF040E16- CTTCCCATCTCCAGATGTGAATGCATTGGGGAAAACTTCGGTTCCAACTCGATTTATTGA
                      ____________________________________________________________
consensus CTTCCCATCTCCAGATGTGAATGCATTGGGGAAAACTTCGGTTCCAACTCGATTTATTGA
 
. : . : . : . : . : . :
rJMFF007K19- AGCTACAAAGTAACTATTTGCTATTGCTGCATTACGAGCCTCGATGGGCCACATTGGTTC
rJMSF017I06- AGCTACAAAGTAACTATTTGCTATTGCTGCATTACGAGCCTCGATGGGCCACATTGGTTC
rJMSF040E16- AGCTACAAAGTAACTATTTGCTATTGCTGCATTACGAGCCTCGATGGGCCACATTGGTTC
                      ____________________________________________________________
consensus AGCTACAAAGTAACTATTTGCTATTGCTGCATTACGAGCCTCGATGGGCCACATTGGTTC
 
. : . : . : . : . : . :
rJMFF007K19- ACTGAGCTCACCGACAGTAGCTGAAGGGTTGAAAACAATCTCAGCTCCATTTAGCCCGAA
rJMSF017I06- ACTGAGCTCACCGACAGTAGCTGAAGGGTTGAAAACAATCTCAGCTCCATTTAGCCCGAA
rJMSF040E16- ACTGAGCTCACCGACAGTAGCTGAAGGGTTGAAAACAATCTCAGCTCCATTTAGCCCGAA
                      ____________________________________________________________
consensus ACTGAGCTCACCGACAGTAGCTGAAGGGTTGAAAACAATCTCAGCTCCATTTAGCCCGAA
 
. : . : . : . : . : . :
rJMFF007K19- AGCTAACCAGTTGAGAGGATGATGCCTTCCATAACATATATTAACACCAATCTTGCCATA
rJMSF017I06- AGCTAACCAGTTGAGAGGATGATGCCTTCCATAACATATATTAACACCAATCTTGCCATA
rJMSF040E16- AGCTAACCAGTTGAGAGGATGATGCCTTCCATAACATATATTAACACCAATCTTGCCATA
                      ____________________________________________________________
consensus AGCTAACCAGTTGAGAGGATGATGCCTTCCATAACATATATTAACACCAATCTTGCCATA
 
. : . : . : . : . : . :
rJMFF007K19- AGCCGTCTCAAAGACAGGATGGCCAGTGTTTCCTTCCATGTAGNATGTACTCTCATTAAA
rJMSF017I06- AGCCGTCTCAAAGACAGGATGGCCAGTGTTTCCTTCCATGTAGTATGTACTCTCATTAAA
rJMSF040E16- AGCCGTCTCAAAGACAGGATGGCCAGTGTTTCCTTCCATGTAGTATGTACTCTCATTAAA
                      ____________________________________________________________
consensus AGCCGTCTCAAAGACAGGATGGCCAGTGTTTCCTTCCATGTAGTATGTACTCTCATTAAA
 
. : . : . : . : . : . :
rJMFF007K19- GTCCCCG
rJMSF017I06- GTCCCCGACTCTAGGTATATGATTCTTCCGGTGTATTCCAATTATGTTACCATGATTTCC
rJMSF040E16- GTCCCCGACTCTAGGTATATGATTCTTCCGGTGTATTCCAATTATGTTACCATGATTTCC
                      ____________________________________________________________
consensus GTCCCCGACTCTAGGTATATGATTCTTCCGGTGTATTCCAATTATGTTACCATGATTTCC
 
. : . : . : . : . : . :
rJMSF017I06- AATTACTACACACGTATTCCAGAGCGTCTCTCCATGGTTTCACATCCCTCTCGAGAATGG
rJMSF040E16- AATTACTACACACGTATTCCAGAGCGTCTCTCCAT-GTTTCACATCCCTCTCGAGAATGG
JMSF040E16+ GTTTCACATCCCTCTCGAGAATGG
JMFN032I20+ AATGG
JMFN006N14+ GTTTCACATCCCTCTCGAGAATGG
JMSF022N13+ ACGTATTCCAGAGCGTCTCTCCAT-GTTTCACATCCCTCTCGAGAATGG
                      ____________________________________________________________
consensus AATTACTACACACGTATTCCAGAGCGTCTCTCCAT-GTTTCACATCCCTCTCGAGAATGG
 
. : . : . : . : . : . :
rJMSF017I06- GACTGATTAT
rJMSF040E16- GACTGATTATGACCATGTTATACTTCCTAGCAAACTCTTGAAGAA
JMSF040E16+ GACTGATTATGACCATGTTATACTTCCTAGCAAACTCTTGAAGAAACAGCGTAGATTCTC
JMFN032I20+ GACTGATTATGACCATGTTATACTTCCTAGCAAACTCTTGAAGAAACAGCGTAGATTCTC
JMFN006N14+ GACTGATTATGACCATGTTATACTTCCTAGCAAACTCTTGAAGAAACAGCGTAGATTCTC
JMSF022N13+ GACTGATTATGACCATGTTATACTTCCTAGCAAACTCTTGAAGAAACAGCGTAGATTCTC
                      ____________________________________________________________
consensus GACTGATTATGACCATGTTATACTTCCTAGCAAACTCTTGAAGAAACAGCGTAGATTCTC
 
. : . : . : . : . : . :
JMSF040E16+ CATCTACTGGCTCAGCAAATTCACACCATCTTTTCTCACGAGTACAGAATGCAAATGGCA
JMFN032I20+ CATCTACTGGCTCAGCAAATTCACACCATCTTTTCTCACGAGTACAGAATGCAAATGGCA
JMFN006N14+ CATCTACTGGCTCAGCAAATTCACACCATCTTTTCTCACGAGTACAGAATGCAAATGGCA
JMSF022N13+ CATCTACTGGCTCAGCAAATTCACACCATCTTTTCTCACGAGTACAGAATGCAAATGGCA
JMSF017I06+ CTCAGCAAATTCACACCATCTTTTCTCACGAGTACAGAATGCAAATGGCA
                      ____________________________________________________________
consensus CATCTACTGGCTCAGCAAATTCACACCATCTTTTCTCACGAGTACAGAATGCAAATGGCA
 
. : . : . : . : . : . :
JMSF040E16+ TCGTCCAGGCCTCTTGCAAACACAGGATATTTACTCCTGCAGTTCCAGCAGCATCGATGA
JMFN032I20+ TCGTCCAGGCCTCTTGCAAACACAGGATATTTACTCCTGCAGTTCCAGCAGCATCGATGA
JMFN006N14+ TCGTCCAGGCCTCTTGCAAACACAGGATATTTACTCCTGCAGTTCCAGCAGCATCGATGA
JMSF022N13+ TCGTCCAGGCCTCTTGCAAACACAGGATATTTACTCCTGCAGTTCCAGCAGCATCGATGA
JMSF017I06+ TCGTCCAGGCCTCTTGCAAACACAGGATATTTACTCCTGCAGTTCCAGCAGCATCGATGA
JMFF007K19+ TCTTGCAAACACAGGATATTTACTCCTGCAGTTCCAGCAGCATCGATGA
                      ____________________________________________________________
consensus TCGTCCAGGCCTCTTGCAAACACAGGATATTTACTCCTGCAGTTCCAGCAGCATCGATGA
 
. : . : . : . : . : . :
JMSF040E16+ TGGGCTTCAACTTCTGAAATATGGCCCTCTTCTGTTCCAAGAAAGGCGCGGTTGTAGGAA
JMFN032I20+ TGGGCTTCAACTTCTGAAATATGGCCCTCTTCTGTTCCAAGAAAGGCGCGGTTGTAGGAA
JMFN006N14+ TGGGCTTCAACTTCTGAAATATGGCCCTCTTCTGTTCCAAGAAAGGCGCGGTTGTAGGAA
JMSF022N13+ TGGGCTTCAACTTCTGAAATATGGCCCTCTTCTGTTCCAAGAAAGGCGCGGTTGTAGGAA
JMSF017I06+ TGGGCTTCAACTTCTGAAATATGGCCCTCTTCTGTTCCAAGAAAGGCGCGGTTGTAGGAA
JMFF007K19+ TGGGCTTCAACTTCTGAAATATGGCCCTCTTCTGTTCCAAGAAAGGCGCGGTTGTAGGAA
                      ____________________________________________________________
consensus TGGGCTTCAACTTCTGAAATATGGCCCTCTTCTGTTCCAAGAAAGGCGCGGTTGTAGGAA
 
. : . : . : . : . : . :
JMSF040E16+ GAGCAATAGAATTCTGAATGAGGCCAACCCTGACAATCCGAGGTTGTCTCAGTGACTCTT
JMFN032I20+ GAGCAATAGAATTCTGAATGAGGCCAACCCTGACAATCCGAGGTTGTCTCAGTGACTCTT
JMFN006N14+ GAGCAATAGAATTCTGAATGAGGCCAACCCTGACAATCCGAGGTTGTCTCAGTGACTCTT
JMSF022N13+ GAGCAATAGAATTCTGAATGAGGCCAACCCTGACAATCCGAGGTTGTCTCAGTGACTCTT
JMSF017I06+ GAGCAATAGAATTCTGAATGAGGCCAACCCTGACAATCCGAGGTTGTCTCAGTGACTCTT
JMFF007K19+ GAGCAATAGAATTCTGAATGAGGCCAACCCTGACAATCCGAGGTTGTCTCAGTGACTCTT
                      ____________________________________________________________
consensus GAGCAATAGAATTCTGAATGAGGCCAACCCTGACAATCCGAGGTTGTCTCAGTGACTCTT
 
. : . : . : . : . : . :
JMSF040E16+ TGTCAGCATGAAACGAAAATGCCTGAAGATCGAAGTCATGTTTTGCTGACAGAGCTTTGG
JMFN032I20+ TGTCAGCATGAAACGAAAATGCCTGAAGATCGAAGTCATGTTTTGCTGACAGAGCTTTGG
JMFN006N14+ TGTCAGCATGAAACGAAAATGCCTGAAGATCGAAGTCATGTTTTGCTGACAGAGCTTTGG
JMSF022N13+ TGTCAGCATGAAACGAAAATGCCTGAAGATCGAAGTCATGTTTTGCTGACAGAGCTTTGG
JMSF017I06+ TGTCAGCATGAAACGAAAATGCCTGAAGATCGAAGTCATGTTTTGCTGACAGAGCTTTGG
JMFF007K19+ TGTCAGCATGAAACGAAAATGCCTGAAGATCGAAGTCATGTTTTGCTGACAGAGCTTTGG
                      ____________________________________________________________
consensus TGTCAGCATGAAACGAAAATGCCTGAAGATCGAAGTCATGTTTTGCTGACAGAGCTTTGG
 
. : . : . : . : . : . :
JMSF040E16+ CAGGCTCAGGAACTTCAATGGCCTCAACTGCTCTCCCACAATTTAGCCCAAGAAGCAAGC
JMFN032I20+ CAGGCTCAGGAACTTCAATGGCCTCAACTGCTCTCCCACAATTTAGCCCAAGAAGCAAGC
JMFN006N14+ CAGGCTCAGGAACTTCAATGGCCTCAACTGCTCTCCCACAATTTAGCCCAAGAAGCAAGC
JMSF022N13+ CAGGCTCAGGAACTTCAATGGCCTCAACTGCTCTCCCACAATTTAGCCCAAGAAGCAAGC
JMSF017I06+ CAGGCTCAGGAACTTCAATGGCCTCAACTGCTCTCCCACAATTTAGCCCAAGAAGCAAGC
JMFF007K19+ CAGGCTCAGGAACTTCAATGGCCTCAACTGATCTCCCACAATTTAGCCCAAGAAGCAAGC
                      ____________________________________________________________
consensus CAGGCTCAGGAACTTCAATGGCCTCAACTGCTCTCCCACAATTTAGCCCAAGAAGCAAGC
 
. : . : . : . : . : . :
JMSF040E16+ GGCTGACTTCCTGAAAGAGTTGGGGGGTGAGGGAAGCTTGAAGGAGGCGATGAAGAGAGT
JMFN032I20+ GGCTGACTTCCTGAAAGAGTTGGGGGGTGAGGGAAGCTTGAAGGAGGCGATGAAGAGAGT
JMFN006N14+ GGCTGACTTCCTGAAAGAGTTGGGGGGTGAGGGAAGCTTGAAGGAGGCGATGAAGAGAGT
JMSF022N13+ GGCTGACTTCCTGAAAGAGTTGGGGGGTGAGGGAAGCTTGAAGGAGGCGATGAAGAGAGT
JMSF017I06+ GGCTGACTTCCTGAAAGAGTTGGGGGGTGAGGGAAGCTTGAAGGAGGCGATGAAGAGAGT
rJMSF022N13+ AAAGAGTTGGGGGGTGNGGGAAGCTTGAAGGAGGCGATGAAGAGAGT
JMFF007K19+ GGCTGACTTCCTGAAAGAGTTGGGGGGTGAGGGAAGCTTGAAGGAGGCGATGAAGAGAGT
                      ____________________________________________________________
consensus GGCTGACTTCCTGAAAGAGTTGGGGGGTGAGGGAAGCTTGAAGGAGGCGATGAAGAGAGT
 
. : . : . : . : . : . :
JMSF040E16+ CGAAGCCACAGATGGAAGCGTTTTTGGAGGTCTCTGTTGTTGGTTGTGCATTACAGTTGC
JMFN032I20+ CGAAGCCACAGATGGAAGCGTTTTTGGAGGTCTCTGTTGTTGGTTGTGCATTACAGTTGC
JMFN006N14+ CGAAGCCACAGATGGAAGCGTTTTTGGAGGTCTCTGTTGTTGGTTGTGCATTACAGTTGC
JMSF022N13+ CGAAGCCACAGATGGAAGCGTTTTTGGAGGTCTCTGTTGTTGGTTGTGCATTACAGTTGC
JMSF017I06+ CGAAGCCACAGATGGAAGCGTTTTTGGAGGTCTCTGTTGTTGGTTGTGCATTACAGTTGC
rJMSF022N13+ NGAAGCCACAGATGGAAGCGNTTTTGGAGGTCTCTGTTGTTGGTTGNGCATTACAGTNGC
JMFF007K19+ CGAAGCCACAGATGGAAGCGTTTTTGGAGGTCTCTGTTGTTGGTTGTGCATTACAGTTGC
                      ____________________________________________________________
consensus CGAAGCCACAGATGGAAGCGTTTTTGGAGGTCTCTGTTGTTGGTTGTGCATTACAGTTGC
 
. : . : . : . : . : . :
JMSF040E16+ CTGATACATCGTTACTGTCCTCTTTCCTGTTCTCCATTTCTTCCTGCGCGATCAGTTCAT
JMFN032I20+ CTGATACATCGTTACTGTCCTCTTTCCTGTTCTCCATTTCTTCCTGCGCGATCAGTTCAT
JMFN006N14+ CTGATACATCGTTACTGTCCTCTTTCCTGTTCTCCATTTCTTCCTGCG
JMSF022N13+ CTGATACATCGTTACTGTCCTCTTTCCTGTTCTCCATTTCTTCCTGCGCGATCAGTTCAT
JMSF017I06+ CTGATACATCGTTACTGTCCTCTTTCCTGTTCTCCATTTCTTCCTGCGCGATCAGTTCAT
rJMSF022N13+ NTGATACATCGNTACCGTCCTNTTTCCTGTTCTCCATTTNTTCCNGCNCGATCAGTTCAT
JMFF007K19+ CTGATACATCGTTACTGTCCTCTTTCCTGTTCTCCATTTCTTCCTGCGCGATCAGTTCAT
                      ____________________________________________________________
consensus CTGATACATCGTTACTGTCCTCTTTCCTGTTCTCCATTTCTTCCTGCGCGATCAGTTCAT
 
. : . : . : . : . : . :
JMSF040E16+ CTCAATTCTCAGCTGGAGAAGATGAGGGTGACGGT
JMFN032I20+ CTCAATTCTCAGCTGGAGAAGA
JMSF022N13+ CTCAATTCTCAGCTGGAGAAGATGAGGGTGACGGT
JMSF017I06+ CTCAATTCTCAGCTGGAGAAGATGAGGGTGACGGT
JMFF007K19+ CTCAATTCTCAGCTGGAGAAGATGAGGGTGACGGTCACGGAGTTGTATGTTGTTGAGTAT
                      ____________________________________________________________
consensus CTCAATTCTCAGCTGGAGAAGATGAGGGTGACGGTCACGGAGTTGTATGTTGTTGAGTAT