Previous Contig 000382:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007I09Sequence593000382 (3)gb:AE005172_8913986e-24Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC000103_153000727000382 (3)gb:AE005172_8913982e-28Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC000103_153000
JMFN016O20Sequence600000382 (3)gb:AE005172_8913981e-28Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC000103_153000

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF007I09- TATTCCTTCNTTCACCAGCGCAGCTTTAC
                      ____________________________________________________________
consensus TATTCCTTCNTTCACCAGCGCAGCTTTAC
 
. : . : . : . : . : . :
rJMFF007I09- AACTTTAATTATAAATGTGAAGAAAATGAGACAATAATTCAGGAACTTTTATCCATAACA
                      ____________________________________________________________
consensus AACTTTAATTATAAATGTGAAGAAAATGAGACAATAATTCAGGAACTTTTATCCATAACA
 
. : . : . : . : . : . :
rJMFF007I09- AAGCATTAACATTAGATTGAAACAGCTAGCCAACATATTACACACACATATATATATGGA
                      ____________________________________________________________
consensus AAGCATTAACATTAGATTGAAACAGCTAGCCAACATATTACACACACATATATATATGGA
 
. : . : . : . : . : . :
rJMFF007I09- CTCCAGGTAGGTTCATAATATAATACAGGATAAGTAAGTAGGTCAATTCAAGATTCCAAT
                      ____________________________________________________________
consensus CTCCAGGTAGGTTCATAATATAATACAGGATAAGTAAGTAGGTCAATTCAAGATTCCAAT
 
. : . : . : . : . : . :
rJMFF007I09- ACGTAGCATGCATTTGAACATTATTAGCAGCAAGATGTTACATTATATTGCCAAAGC-TT
JMFN016O20+ TGCCAAAGCTTT
                      ____________________________________________________________
consensus ACGTAGCATGCATTTGAACATTATTAGCAGCAAGATGTTACATTATATTGCCAAAGCTTT
 
. : . : . : . : . : . :
rJMFF007I09- CCCAAACATGAATTTTCAGAAACAACTTCCCAGCACTGTCTGTACTCTCTGTGTCCAAAC
JMFN016O20+ CCCAAACATGAATTTTCAGAAACAACTTCCCAGCACTGTCTGTACTCTCTGTGTCCAAAC
JMFF007I09+ ATGAATTTTCAGAAACAACTTCCCAGCACTGTCTGTACTCTCTGTGTCCAAAC
                      ____________________________________________________________
consensus CCCAAACATGAATTTTCAGAAACAACTTCCCAGCACTGTCTGTACTCTCTGTGTCCAAAC
 
. : . : . : . : . : . :
rJMFF007I09- AAACTGCCCCAAGAATTGCCCGGAAAGCTCCACACACCACTGAAGGAGTTGTGGAATTGG
JMFN016O20+ AAACTGCCCCAAGAATTGCCCGGAAAGCTCCACACACCACTGAAGGAGTTGTGGAATTGG
JMFF007I09+ AAACTGCCCCAAGAATTGCCCGGAAAGCTCCACACACCACTGAAGGAGTTGTGGAATTGG
                      ____________________________________________________________
consensus AAACTGCCCCAAGAATTGCCCGGAAAGCTCCACACACCACTGAAGGAGTTGTGGAATTGG
 
. : . : . : . : . : . :
rJMFF007I09- TATTGGACGAAACTCTAACTATATTCTGCAAATTCAACCGCATTCCATCTCCTGCACATG
JMFN016O20+ TATTGGACGAAACTCTAACTATATTCTGCAAATTCAACCGCATTCCATCTCCTGCACATG
JMFF007I09+ TATTGGACGAAACTCTAACTATATTCTGCAAATTCAACCGCATTCCATCTCCTGCACATG
                      ____________________________________________________________
consensus TATTGGACGAAACTCTAACTATATTCTGCAAATTCAACCGCATTCCATCTCCTGCACATG
 
. : . : . : . : . : . :
rJMFF007I09- AAGTCTCCACCTTTGACGCTTCGGAAATTTTATCGTTGAGGTCGCTGGAGGAAGTGTCAA
JMFN016O20+ AAGTCTCCACCTTTGACGCTTCGGAAATTTTATCGTTGAGGTCGCTGGAGGAAGTGTCAA
JMFF007I09+ AAGTCTCCACCTTTGACGCTTCGGAAATTTTATCGTTGAGGTCGCTGGAGGAAGTGTCAA
                      ____________________________________________________________
consensus AAGTCTCCACCTTTGACGCTTCGGAAATTTTATCGTTGAGGTCGCTGGAGGAAGTGTCAA
 
. : . : . : . : . : . :
rJMFF007I09- TGTTGTGTACTAGCAACAGCATTGACACCGATAT-CTCGATCACTTTCTCTCCCAGGATG
JMFN016O20+ TGTTGTGTACTAGCAACAGCATTGACACCGATAT-CTCGATCACTTTCTCTCCCAGGATG
JMFF007I09+ TGTTGTGTACTAGCAACAGCATTGACACCGATATCCTCGATCACTTTCTCTCCCAGGATG
                      ____________________________________________________________
consensus TGTTGTGTACTAGCAACAGCATTGACACCGATAT-CTCGATCACTTTCTCTCCCAGGATG
 
. : . : . : . : . : . :
rJMFF007I09- CTCAGAGCTTTGTTATTCTCCTCTGAGTACGAGGAATGCGTCATAGCACGTCGAAGCAAC
JMFN016O20+ CTCAGAGCTTTGTTATTCTCCTCTGAGTACGAGGAATGCGTCATAGCACGTCGAAGCAAC
JMFF007I09+ CTCAGAGCTTTGTTATTCTCCTCTGAGTACGAGGAATGCGTCATAGCACGTCGAAGCAAC
                      ____________________________________________________________
consensus CTCAGAGCTTTGTTATTCTCCTCTGAGTACGAGGAATGCGTCATAGCACGTCGAAGCAAC
 
. : . : . : . : . : . :
rJMFF007I09- CCAACATTCTCAAATGTATAGTTGATTTGAGCTTGAAGGGTATCGAGAGCAACGGAGAAG
JMFN016O20+ CCAACATTCTCAAATGTATAGTTGATTTGAGCTTGAAGGGTATCGAGAGCAACGGAGAAG
JMFF007I09+ CCAACATTCTCAAATGTATAGTTGATTTGAGCTTGAAGGGTATCGAGAGCAACGGAGAAG
                      ____________________________________________________________
consensus CCAACATTCTCAAATGTATAGTTGATTTGAGCTTGAAGGGTATCGAGAGCAACGGAGAAG
 
. : . : . : . : . : . :
rJMFF007I09- GGGGACTTGGAGAGTGATGGATCANCATTAACCTGGAGAG
JMFN016O20+ GGGGACTTGGAGAGTGATGGATCAGCATTAACCTGGAGAGAGGAGCAGATCGCGGCGGCT
JMFF007I09+ GGGGACTTGGAGAGTGATGGATCAGCATTAACCTGGAGAGAGGAGCAGATCGCGGCGGCT
                      ____________________________________________________________
consensus GGGGACTTGGAGAGTGATGGATCAGCATTAACCTGGAGAGAGGAGCAGATCGCGGCGGCT
 
. : . : . : . : . : . :
JMFN016O20+ ACGAGGAAGAAGGTGGAAATATAATCCCGGGAAATCATGATCTTCATTCTTCAGTCAGTA
JMFF007I09+ ACGAGGAAGAAGGTGGAAATATAATCCCGGGAAATCATGATCTTCATTCTTCAGTCAGTA
                      ____________________________________________________________
consensus ACGAGGAAGAAGGTGGAAATATAATCCCGGGAAATCATGATCTTCATTCTTCAGTCAGTA
 
. : . : . : . : . : . :
JMFN016O20+ TAGTGAAGTTGAGTTGATGAGTTCTACTTCTTCCGAAAAGTCTTCCC
JMFF007I09+ TAGTGAAGTTGAGTTGATGAGTTCTACTTCTTCCGAAAAGTCTTCCCTCTGATCGACGGT
                      ____________________________________________________________
consensus TAGTGAAGTTGAGTTGATGAGTTCTACTTCTTCCGAAAAGTCTTCCCTCTGATCGACGGT