Previous Contig 000380:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007H09Sequence559000380 (2)753008498 (3)gb:AF064788_17655091e-39Lotus japonicus rac GTPase activating protein 2 mRNA, partial cds.
JMSF007E08Sequence260000380 (2)753008498 (3)gb:AF064788_17655091e-39Lotus japonicus rac GTPase activating protein 2 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007H09+ CTCTCGACGCTGCAAGTAA
                      ____________________________________________________________
consensus CTCTCGACGCTGCAAGTAA
 
. : . : . : . : . : . :
JMFF007H09+ CCAGCGACTTTCTCAGCGCCGCCATCAGCACCGCAAGTATGGGGCTCTGAGTAGCGTGGG
                      ____________________________________________________________
consensus CCAGCGACTTTCTCAGCGCCGCCATCAGCACCGCAAGTATGGGGCTCTGAGTAGCGTGGG
 
. : . : . : . : . : . :
JMSF007E08+ TCGTCCTAGCGGTGCCATTGA
JMFF007H09+ TGTGGCCTCCTCGGTTTTTACGCCGAAACGGTGTCGTCGTCGTCCTAGCGGTGCCATTGA
                      ____________________________________________________________
consensus TGTGGCCTCCTCGGTTTTTACGCCGAAACGGTGTCGTCGTCGTCCTAGCGGTGCCATTGA
 
. : . : . : . : . : . :
JMSF007E08+ AAAAGAAGCCAGAATATCTTCGTTTCACATTATTATTGTCTTGTTCGTCGTCGTCGTCGT
JMFF007H09+ AAAAGAAGCCAGAATATCTTCGTTTCACATTATTATTGTCTTGTTCGTCGTCGTCGTCGT
                      ____________________________________________________________
consensus AAAAGAAGCCAGAATATCTTCGTTTCACATTATTATTGTCTTGTTCGTCGTCGTCGTCGT
 
. : . : . : . : . : . :
JMSF007E08+ CGTCGCCGGCGCACACAGAATGAGAACCATTAAATCCGGCCAAGGGATAGGACTTGGATC
JMFF007H09+ CGTCGCCGGCGCACACAGAATGAGAACCATTAAATCCGGCCAAGGGATAGGACTTGGATC
                      ____________________________________________________________
consensus CGTCGCCGGCGCACACAGAATGAGAACCATTAAATCCGGCCAAGGGATAGGACTTGGATC
 
. : . : . : . : . : . :
JMSF007E08+ GAAACAGACGAGTCATGGGTGTGGATCATGAACAAAGAAGCTAAGCTAGGTAGCTAGAAG
JMFF007H09+ GAAACAGACGAGTCATGGGTGTGGATCATGAACAAAGAAGCTAAGCTAGGTAGATAGAAG
                      ____________________________________________________________
consensus GAAACAGACGAGTCATGGGTGTGGATCATGAACAAAGAAGCTAAGCTAGGTAGCTAGAAG
 
. : . : . : . : . : . :
JMSF007E08+ GAGAAGATGAAGATTCCATAGAATAGAATTGAAGAAGAAGAAGAAGACGAAAGAGATT
JMFF007H09+ GAGAAGATGAAGATTCCATAGAATAGAATTGAAGAAGAAGAAGAAGACGAAAGAGATTGA
                      ____________________________________________________________
consensus GAGAAGATGAAGATTCCATAGAATAGAATTGAAGAAGAAGAAGAAGACGAAAGAGATTGA
 
. : . : . : . : . : . :
JMFF007H09+ GGGTTGAGCGAATTGAAGGAAGATAACAATGAAGGAGTTGGGACAGATCGGGTTGGGGAA
                      ____________________________________________________________
consensus GGGTTGAGCGAATTGAAGGAAGATAACAATGAAGGAGTTGGGACAGATCGGGTTGGGGAA
 
. : . : . : . : . : . :
JMFF007H09+ AACGACATGATTATGATTATTATTAGAGTGTGTTGGGACAGACAACGTTATTGTTATTAA
                      ____________________________________________________________
consensus AACGACATGATTATGATTATTATTAGAGTGTGTTGGGACAGACAACGTTATTGTTATTAA
 
. : . : . : . : . : . :
JMFF007H09+ TCAGAAATTCCACCCAGTATTATGTATGTATGTATGGGCTCGTGACCTCACCTCACCGGT
                      ____________________________________________________________
consensus TCAGAAATTCCACCCAGTATTATGTATGTATGTATGGGCTCGTGACCTCACCTCACCGGT