Previous Contig 000376:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001E13Sequence447000376 (28)gb:AY573572_16158369e-50Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete 242004010 (8)
JMFF004E07Sequence162000376 (28)704004010 (8)gb:AF304374_17843854e-41Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMFF007G16Sequence550000376 (28)
JMFF012B07Sequence521000376 (28)gb:AF304374_17843851e-81Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.723004010 (8)gb:AF304374_17843851e-38Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMFF021J17Sequence527000376 (28)
JMFF041P23Sequence643000376 (28)gb:AY573572_16158365e-61Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete 644004010 (8)gb:AF304374_17843852e-34Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMFF049M13Sequence493000376 (28)gb:AF304374_17843854e-50Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.467010930 (3)
JMFF050A17Sequence636000376 (28)gb:AY573572_16158363e-60Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete 614010930 (3)gb:AP003076_18246501e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048
JMFS007A08Sequence635000376 (28)gb:AY573572_1615836e-110Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete
JMFS007C06Sequence623000376 (28)gb:AY221088_15905348e-91Solanum tuberosum cellulose synthase (StCesA4) mRNA, partial cds.
JMFS015D01Sequence511000376 (28)gb:AY573572_16158362e-60Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete
JMFS057F03Sequence594000376 (28)gb:AF304374_17843854e-77Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMFS062A10Sequence642000376 (28)gb:AY573572_1615836e-114Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete
JMFS073C06Sequence616000376 (28)gb:AY573572_16158366e-88Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete
JMFS077F01Sequence654000376 (28)gb:AY573572_16158366e-69Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete
JMFS078A06Sequence626000376 (28)gb:AF304374_17843854e-10Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMFS092G08Sequence623000376 (28)gb:AY573572_16158363e-52Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete
JMFS096H05Sequence626000376 (28)gb:AF304374_17843851e-84Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMFS098C12Sequence627000376 (28)gb:AF304374_17843853e-16Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMFS100C05Sequence601000376 (28)gb:AY221086_15905321e-68Solanum tuberosum cellulose synthase (StCesA1) mRNA, partial cds.
JMFS112G02Sequence620000376 (28)gb:AF304374_17843858e-14Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMFS136A07Sequence602000376 (28)gb:AY573572_16158362e-98Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete
JMFS147D09Sequence620000376 (28)gb:AY573572_16158365e-61Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete
JMFS164E05Sequence626000376 (28)gb:AY573572_16158367e-47Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete
JMFS165A05Sequence614000376 (28)gb:AF304374_17843854e-83Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMSF022G13Sequence631000376 (28)gb:AY573572_1615836e-114Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete 798004010 (8)gb:AF304374_17843853e-44Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.
JMSF037B04Sequence689000376 (28)pir|T08583|T085831e-85cellulose synthase (EC 2.4.1.-) catalytic chain - Arabidopsis thaliana>gb:ATCHRI179008668 (10)
JMSF046D10Sequence744000376 (28)gb:AY573572_16158362e-49Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete 707004010 (8)gb:AF304374_17843853e-40Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF012B07+ TACCAAATAGGGCAATGTTTGCTCAGTAAAATCTCAAC
                      ____________________________________________________________
consensus TACCAAATAGGGCAATGTTTGCTCAGTAAAATCTCAAC
 
. : . : . : . : . : . :
JMFF012B07+ AGATCCCAATGCCCACCGAAGAACCTGGTGCAAACGATCTGAAAGGTTGATGGGAGCAGA
                      ____________________________________________________________
consensus AGATCCCAATGCCCACCGAAGAACCTGGTGCAAACGATCTGAAAGGTTGATGGGAGCAGA
 
. : . : . : . : . : . :
JMFF012B07+ CCCTTTGAACGCGGGCCTTCTAGGCATGCAGTACACAGATCGCCAGCCATGACAGTGCAT
                      ____________________________________________________________
consensus CCCTTTGAACGCGGGCCTTCTAGGCATGCAGTACACAGATCGCCAGCCATGACAGTGCAT
 
. : . : . : . : . : . :
JMFF012B07+ CTTAAACCCGGTTAAGATATCCTCAGTAACAGAGCCGTAAATCCATCCAACCTCCTTTCC
                      ____________________________________________________________
consensus CTTAAACCCGGTTAAGATATCCTCAGTAACAGAGCCGTAAATCCATCCAACCTCCTTTCC
 
. : . : . : . : . : . :
JMFF012B07+ CCATTCGGTTTTGTCTTCGTAACCACAACTTATGACATGGATAGCTTCTTTCAAAAGGGA
                      ____________________________________________________________
consensus CCATTCGGTTTTGTCTTCGTAACCACAACTTATGACATGGATAGCTTCTTTCAAAAGGGA
 
. : . : . : . : . : . :
JMFF012B07+ TGCTGATGTTGCTCCCGGGGGAATACCACCGTTCTCAAGTAGTGTTGAAGCTACAAAAAC
JMSF037B04+ GTTGAAGCGACAAAAAC
                      ____________________________________________________________
consensus TGCTGATGTTGCTCCCGGGGGAATACCACCGTTCTCAAGTAGTGTTGAAGCTACAAAAAC
 
. : . : . : . : . : . :
JMFF012B07+ AGGTGACTGCCCAAATTTTTTCTCGAGTTTAATTTGAGGCATCAGAGATGCTTTGACACT
JMSF037B04+ CGGTGATTGGCCGAATTTCTTCTCGAGTTTTATTTGGGGCATGAGTGATGCTTT-TTTCT
                      ____________________________________________________________
consensus CGGTGATTGGCCGAATTTTTTCTCGAGTTTTATTTGGGGCATGAGTGATGCTTTGTTTCT
 
. : . : . : . : . : . :
JMFF012B07+ ATCAATTCCTTCAATTCCCTCCTCGATATTTTCTAGAGCATGAATCTGCGTTGAAGCTTC
JMSF037B04+ TTCGATTCCTTCGATTCCTTCCTCGATATTTTCCAGAGCATGAATCTGCGGTGAAGAATC
                      ____________________________________________________________
consensus TTCGATTCCTTCGATTCCTTCCTCGATATTTTCTAGAGCATGAATCTGCGTTGAAGCTTC
 
. : . : . : . : . : . :
JMFF012B07+ CTTGGCTTTAGTCTTCTTTTTATCCTTTGATTTTCCTTT
JMSF037B04+ CTTGGTTTTAGTCTTCTTTTTGTCCTTGGATTTTGCTTTCTTATTCTTTCGAGATCGACA
                      ____________________________________________________________
consensus CTTGGTTTTAGTCTTCTTTTTGTCCTTTGATTTTGCTTTCTTATTCTTTCGAGATCGACA
 
. : . : . : . : . : . :
JMSF037B04+ ACAACAACAAAACAGTTTCGACCAACAATTGCACGTTTTGCCTGGACGTTTCTTCTTCTT
                      ____________________________________________________________
consensus ACAACAACAAAACAGTTTCGACCAACAATTGCACGTTTTGCCTGGACGTTTCTTCTTCTT
 
. : . : . : . : . : . :
JMSF037B04+ CGGGGCATCATATCCATAAAGAGCTTGCCTCCTGAAGACACAACCAGTTCCGACGTATAT
                      ____________________________________________________________
consensus CGGGGCATCATATCCATAAAGAGCTTGCCTCCTGAAGACACAACCAGTTCCGACGTATAT
 
. : . : . : . : . : . :
JMSF037B04+ CGGGCCTTGAATCCCGTCAAGTCCTTTCATATTTATATCAAAGAAGACAACGTTACGATT
                      ____________________________________________________________
consensus CGGGCCTTGAATCCCGTCAAGTCCTTTCATATTTATATCAAAGAAGACAACGTTACGATT
 
. : . : . : . : . : . :
JMSF037B04+ CGAGTATCGATCGTGCCGATCAATACCGTCAAATCGTTGTGGAAACTGCACGTAGCATAT
                      ____________________________________________________________
consensus CGAGTATCGATCGTGCCGATCAATACCGTCAAATCGTTGTGGAAACTGCACGTAGCATAT
 
. : . : . : . : . : . :
JMSF037B04+ CTTTTTCCCGGACTGGGGGTCCATCATAAAGCACATAGCTTCTCGGAGTGCCTTGCTGTT
JMSF022G13+ GGTCCATCATAAAACACATAGCTTCTCGGAGTGCCTTGCTGTT
                      ____________________________________________________________
consensus CTTTTTCCCGGACTGGGGGTCCATCATAAAGCACATAGCTTCTCGGAGTGCCTTGCTGTT
 
. : . : . : . : . : . :
JMSF037B04+ ATTGATGTAGTGATCACAATCCACATTGAGTAGAAAAGGAGCGTTCGAGATGACAGCTGA
JMSF022G13+ ATTGATATAATGATCACAATCCACATTAAGTATGTAAGGAGCATTTGAGATGACAGCCGA
                      ____________________________________________________________
consensus ATTGATGTAGTGATCACAATCCACATTGAGTATGTAAGGAGCGTTTGAGATGACAGCTGA
 
. : . : . : . : . : . :
JMSF037B04+ AACCCGCACCAGTGAATTCATGGCACCGGCCTTTTTGTGGTGCTCGAAACCGGGCCTCTT
JMSF022G13+ CACTCGGACCAATGAATTCATAGCCCCCGCTTTTTTGTGGTGTTCATAGCCTGGCCTCTT
JMFS062A10+ CAATGAATTCATAGCCNCCGCTTTTNTGTGGTGTTCATAGCCTGGCCTCTT
                      ____________________________________________________________
consensus CACTCGGACCAATGAATTCATAGCCCCCGCTTTTTTGTGGTGTTCATAGCCTGGCCTCTT
 
. : . : . : . : . : . :
JMSF037B04+ CTCACGAGAAACGTAAATAAGACGAGGCAATTCATTGCCCTCGATGTCCCGGACACCATC
JMSF022G13+ CTCACGAGAAACATAAACGAGACGAGGCAGTTCATTGCCTTCAATGTCATGGACACCATC
JMFS062A10+ CTCACGAGAAACATAAACGAGACGAGGCAGTTCATTGCCTTCAATGTCATGGACACCATC
JMFS007A08+ CCATC
                      ____________________________________________________________
consensus CTCACGAGAAACATAAACGAGACGAGGCAGTTCATTGCCTTCAATGTCATGGACACCATC
 
. : . : . : . : . : . :
JMSF037B04+ ATGGCC
JMSF022G13+ GTGGCCCAGGAAAACCTGGATCATTCCAGGGTGATCCCTGACATTGTTTCCAGGCCAAGG
JMFS062A10+ GTGGCCCAGGAAAACCTGGATCATTCCAGGGTGATCCCTGACATTGTTTCCAGGCCAAGG
JMFS007A08+ GTGGCCCAGGAAAACCTGGATCATTCCAGGGTGATCCCTGACATTGTTTCCAGGCCAAGG
                      ____________________________________________________________
consensus GTGGCCCAGGAAAACCTGGATCATTCCAGGGTGATCCCTGACATTGTTTCCAGGCCAAGG
 
. : . : . : . : . : . :
JMSF022G13+ AGTGCCATCTTGCATGGTCCACCCATCCTCAGGAACCTTCTGTGCCATGGCAACCAACCC
JMFS062A10+ AGTGCCATCTTGCATGGTCCACCCATCCTCAGGAACCTTCTGTGCCATGGCAACCAACCC
JMFS007A08+ AGTGCCATCTTGCATGGTCCACCCATCCTCAGGAACCTTCTGTGCCATGGCAACCAACCC
JMFS136A07+ GTGCCATGGCAACCAACCC
                      ____________________________________________________________
consensus AGTGCCATCTTGCATGGTCCACCCATCCTCAGGAACCTTCTGTGCCATGGCAACCAACCC
 
. : . : . : . : . : . :
JMSF022G13+ ATTGATCCGAACCTTAAACTCCTCATACTCTCTCTTAATTGCTCTTCGTTCCCTCACAAA
JMFS062A10+ ATTGATCCGAACCTTAAACTCCTCATACTCTCTCTTAATTGCTCTTCGTTCCCTCACAAA
JMFS007A08+ ATTGATCCGAACCTTAAACTCCTCATACTCTCTCTTAATTGCTCTTCGTTCCCTCACAAA
JMFS136A07+ ATTGATCCGAACCTTAAACTCCTCATACTCTCTCTTAATTGCTCTTCGTTCCCTCACAAA
                      ____________________________________________________________
consensus ATTGATCCGAACCTTAAACTCCTCATACTCTCTCTTAATTGCTCTTCGTTCCCTCACAAA
 
. : . : . : . : . : . :
JMSF022G13+ AGTTGGATCCACTTTGTTTCTCAGATAATCAATCTTCTGAGCAAAGTACCACTCCGGTGC
JMFS062A10+ AGTTGGATCCACTTTGTTTCTCAGATAATCAATCTTCTGAGCAAAGTACCACTCCGGTGC
JMFS007A08+ AGTTGGATCCACTTTGTTTCTCAGATAATCAATCTTCTGAG-AAAGTACCACTCCGGTGC
JMFS136A07+ AGTTGGATCCACTTTGTTTCTCAGATAATCAATCTTCTGAGCAAAGTACCACTCCGGTGC
JMFS007C06+ GAGCAAAGTACCACTCCGGTGC
                      ____________________________________________________________
consensus AGTTGGATCCACTTTGTTTCTCAGATAATCAATCTTCTGAGCAAAGTACCACTCCGGTGC
 
. : . : . : . : . : . :
JMSF022G13+ CCGTGGTTCTATGCAGTATCTTTTACAGAATGGGACCCATTTCCTTGCGAATTCAGATGT
JMFS062A10+ CCGTGGTTCTATGCAGTATCTTTTACAGAATGGGACCCATTTCCTTGCGAATTCAGATGT
JMFS007A08+ CCGTGGTTCTATGCAGTATCTTTTACAGAATGGGACCCATTTCCTTGCGAATTCAGATGT
JMFS136A07+ CCGTGGTTCTATGCAGTATCTTTTACAGAATGGGACCCATTTCCTTGCGAATTCAGATGT
JMFS007C06+ CCGTGGTTCTATGCAGTATCTTTTACAGAATGGGACCCATTTCCTTGCGAATTCAGATGT
JMFS073C06+ GCGAATTCAGATGT
                      ____________________________________________________________
consensus CCGTGGTTCTATGCAGTATCTTTTACAGAATGGGACCCATTTCCTTGCGAATTCAGATGT
 
. : . : . : . : . : . :
JMSF022G13+ CTCAGACAGGGCCTCAAAGGTAAGCATGGCAGCACCATCATCCGAGACATAGCACGAGAC
JMFS062A10+ CTCAGACAGGGCCTCAAAAGTAAGCATGGCAGCACCATCATCCGAGACATAGCACGAGAC
JMFS007A08+ CTCAGACAGGGCCTCAAAAGTAAGCATGGCAGCACCATCATCCGAGACATAGCACGAGAC
JMFS136A07+ CTCAGACAGGGCTTCAAAAGTAAGCATGGCAGCACCATCATCCAAGACATAGCACGAGAC
JMFS007C06+ CTCAGACAGGGCCTCAAAAGTAAGCATGGCAGCACCATCATCCGAGACATAGCACGAGAC
JMFS073C06+ CTCAGACAGGGCCTCAAAAGTAAGCATGGCAGCACCATCATCCGAGACATAGCACGAGAC
                      ____________________________________________________________
consensus CTCAGACAGGGCCTCAAAAGTAAGCATGGCAGCACCATCATCCGAGACATAGCACGAGAC
 
. : . : . : . : . : . :
JMSF022G13+ CTTGTCGACTGGATAATCTACAGCGAGGATGGAGAGAACAGTATTTGC
JMFS062A10+ CTTGTCGACTGGATAATCTACAGCGAGGATGGAGAGAACAGTATTTGCAGTTATGAGTGG
JMFS007A08+ CTTGTCGACTGGATAATCTACAGCGAGGATGGAGAGAACAGTATTTGCAGTTATGAGTGG
JMFS136A07+ CTTGTCGACTGGATAATCTACAGCGAGGATGGAGAGAACAGTATTTGCAGTTATGAGTGG
JMFS007C06+ CTTGTCGACTGGATAATCTACAGCGAGGATGGAGAGAACAGTATTTGCAGTTATGAGTGG
JMFS073C06+ CTTGTCGACTGGATAATCTACAGCGAGGATGGAGAGAACAGTATTTGCAGTTATGAGTGG
                      ____________________________________________________________
consensus CTTGTCGACTGGATAATCTACAGCGAGGATGGAGAGAACAGTATTTGCAGTTATGAGTGG
 
. : . : . : . : . : . :
JMFS062A10+ AGGTTCTTTCATGGGATCCACAGTACTCACAAATATGTCAATATGGGCCAACTCAGAAGG
JMFS007A08+ AGGTTCTTTCATGGGATCCACAGTACTCACAAATATGTCAATATGGGCCAACTCAGAAGG
JMFS136A07+ AGGTTCTTTCATGGGATCCACAGTACTCACAAATATGTCAATATGGGCCAACTCAGAAGG
JMFS007C06+ AGGTTCTTTCATGGGATCCACAGTACTCACAAATATGTCAATATGGGCCAACTCAGAAGG
JMFS073C06+ AGGTTCTTTCATGGGATCCACAGTACTCACAAATATGTCAATATGGGCCAACTCAGAAGG
JMFS165A05+ TTCATGGGATCCACAGTACTCACAAATATGTCAATATGGGCCAACTCAGAAGG
                      ____________________________________________________________
consensus AGGTTCTTTCATGGGATCCACAGTACTCACAAATATGTCAATATGGGCCAACTCAGAAGG
 
. : . : . : . : . : . :
JMFS062A10+ CTTCCCTTCTTTGTCATACCTAAGTGACAGTCTATCTAAGTACGTTTCTCG
JMFS007A08+ CTTCCCTTCTTTGTCATACCTAAGTGACAGTCTATCTAAGTACGTTTCTCGCTCAATAGG
JMFS136A07+ CTTCCCTTCTTTGTCATACCTAAGTGACAGTCTATCTAAGTACGTTTCTCGCTCAATAGG
JMFS007C06+ CTTCCCTTCTTTGTCATACCTAAGTGACAGTCTATCTAAGTACGTTTCTCGCTCAATAGG
JMFS073C06+ CTTCCCTTCTTTGTCATACCTAAGTGACAGTCTATCTAAGTACGTTTCTCGCTCAATAGG
JMFS165A05+ CTTCCCTTCTTTGTCATACCTAAGTGACAGTCTATCTAAGTACGTTTCTCGCTCAATAGG
JMFS096H05+ CTTTGTCATACCTAAGTGACAGTCTATCTAAGTACGTTTCTCGCTCAATAGG
                      ____________________________________________________________
consensus CTTCCCTTCTTTGTCATACCTAAGTGACAGTCTATCTAAGTACGTTTCTCGCTCAATAGG
 
. : . : . : . : . : . :
JMFS007A08+ GAACCATTTCGGGAACTGATCAAATATCCACGATACAGCAAACCAAATCTCACATATAAT
JMFS136A07+ GAACCATTTCGGGAACTGATCAAATATCCACGATACAGCAAACCAAATCTCACATATAAT
JMFS007C06+ GAACCATTTCGGGAACTGATCAAATATCCACGATACAGCAAACCAAATCTCACATATAAT
JMFS073C06+ GAACCATTTCGGGAACTGATCAAATATCCACGATACAGCAAACCAAATCTCACATATAAT
JMFS165A05+ GAACCATTTCGGGAACTGATCAAATATCCACGATACAGCAAACCAAATCTCACATATAAT
JMFS096H05+ GAACCATTTCGGGAACTGATCAAATATCCACGATACAGCAAACCAAATCTCACATATAAT
JMFS100C05+ T
                      ____________________________________________________________
consensus GAACCATTTCGGGAACTGATCAAATATCCACGATACAGCAAACCAAATCTCACATATAAT
 
. : . : . : . : . : . :
JMFS007A08+ AGAAGTCAGCCACAAACCATATGCATCATTG
JMFS136A07+ AGAAGTCAGCCACAAACCATATGCATCATTGACAGGGTGGAGAATTCTATAATGGAAAAA
JMFS007C06+ AGAAGTCAGCCACAAACCATATGCATCATTGACAGGGTGGAGAATTCTATAATGGAAAAA
JMFS073C06+ AGAAGTCAGCCACAAACCATATGCATCATTGACAGGGTGGAGAATTCTATAATGGAAAAA
JMFS165A05+ AGAAGTCAGCCACAAACCATATGCATCATTGACAGGGTGGAGAATTCTATAATGGAAAAA
JMFS096H05+ AGAAGTCAGCCACAAACCATATGCATCATTGACAGGGTGGAGAATTCTATAATGGAAAAA
JMFS100C05+ AGAAGTCAGCCACAAACCATATGCATCATTGACAGGGTGGAGAATTCTATAATGGAAAAA
                      ____________________________________________________________
consensus AGAAGTCAGCCACAAACCATATGCATCATTGACAGGGTGGAGAATTCTATAATGGAAAAA
 
. : . : . : . : . : . :
JMFS136A07+ CAACCCAAGAATCACCAAGCGGAGTAAAATGATTAATCTGTAA
JMFS007C06+ CAACCCAAGAATCACCAAGCGGAGTAAAATGATTAATCTGTAAGGGCTTAGTTTGCTCGA
JMFS073C06+ CAACCCAAGAATCACCAAGCGGAGTAAAATGATTAATCTGTAAGGGCTTAGTTTGCTCGA
JMFS165A05+ CAACCCAAGAATCACCAAGCGGAGTAAAATGATTAATCTGTAAGGGCTTAGTTTGCTCGA
JMFS096H05+ CAACCCAAGAATCACCAAGCGGAGTAAAATGATTAATCTGTAAGGGCTTAGTTTGCTCGA
JMFS100C05+ CAACCCAAGAATCACCAAGCGGAGTAAAATGATTAATCTGTAAGGGCTTAGTTTGCTCGA
                      ____________________________________________________________
consensus CAACCCAAGAATCACCAAGCGGAGTAAAATGATTAATCTGTAAGGGCTTAGTTTGCTCGA
 
. : . : . : . : . : . :
JMFS007C06+ GGAAATCGGTATCTTCCTTGAAAGTGGCTGTCTACCTTCATCCATCTTAAGCAAATCGGG
JMFS073C06+ GGAAATCGGTATCTTCCTTGAAAGTGGCTGTCTACCTTCATCCATCTTAAGCAAATCGGG
JMFS165A05+ GGAAATCGGTATCTTCCTTGAAAGTGGCTGTCTACCTTCATCCATCTTAAGCAAATCGGG
JMFS096H05+ GGAAATCGGTATCTTCCTTGAAAGTGGCTGTCTACCTTCATCCATCTTAAGCAAATCGGG
JMFS100C05+ GGAAATCGGTATCTTCCTTGAAAGTGGCTGTCTACCTTCATCCATCTTAAGCAAATCGGG
                      ____________________________________________________________
consensus GGAAATCGGTATCTTCCTTGAAAGTGGCTGTCTACCTTCATCCATCTTAAGCAAATCGGG
 
. : . : . : . : . : . :
JMFS007C06+ ATCATCCGGCTCATCTCCACCGTTCTTCCCACCACCTTTATCTCCTTCATGCTTAACCAC
JMFS073C06+ ATCATCCGGCTCATCTCCACCGTTCTTCCCACCACCTTTATCTCCTTCATGCTTAACCAC
JMFS165A05+ ATCATCCGGCTCATCTCCACCGTTCTTCCCACCACCTTTATCTCCTTCATGCTTAACCAC
JMFS096H05+ ATCATCCGGCTCATCTCCACCGTTCTTCCCACCACCTTTATCTCCTTCATGCTTAACCAC
JMFS100C05+ ATCATCCGGCTCATCTCCACCGTTCTTCCCACCACCTTTATCTCCTTCATGCTTAACCAC
                      ____________________________________________________________
consensus ATCATCCGGCTCATCTCCACCGTTCTTCCCACCACCTTTATCTCCTTCATGCTTAACCAC
 
. : . : . : . : . : . :
JMFS007C06+ C
JMFS073C06+ CTGCAGCTTATCACCCTGCTTTTTTTTCCATTCCTCCATTCTTTCTTTCCATGCAACAGT
JMFS165A05+ CTGCAGCTTATCACCCTGCTTTTTTTTCCATTCCTCCATTCTTTCTTTCCATGCAACAGT
JMFS096H05+ CTGCAGCTTATCACCCTGCTTTTTTTTCCATTCCTCCATTCTTTCTTTCCATGCAACAGT
JMFS100C05+ CTGCAGCTTATCACCCTGCTTTTTTTTCCATTCCTCCATTCTTTCTTTCCATGCAACAGT
JMFS057F03+ TGCAGCTTATCACCCTGCTTTTTTTTCCATTCCTCCATTCTTTCTTTCCATGCAACAGT
                      ____________________________________________________________
consensus CTGCAGCTTATCACCCTGCTTTTTTTTCCATTCCTCCATTCTTTCTTTCCATGCAACAGT
 
. : . : . : . : . : . :
JMFS073C06+ GC
JMFS165A05+ GCCATAACCATAGACTGCCAAGTCCTTCTTTGGATCCATTGGTCGAGGTGGCAATGAGGT
JMFS096H05+ GCCATAACCATAGACTGCCAAGTCCTTCTTTGGATCCATTGGTCGAGGTGGCAATGAGGT
JMFS100C05+ GCCATAACCATAGACTGCCAAGTCCTTCTTTGGATCCATTGGTCGAGGTGGCAATGAGGT
JMFS057F03+ GCCATAACCATAGACTGCCAAGTCCTTCTTTGGATCCATTGGTCGAGGTGGCAATGAGGT
                      ____________________________________________________________
consensus GCCATAACCATAGACTGCCAAGTCCTTCTTTGGATCCATTGGTCGAGGTGGCAATGAGGT
 
. : . : . : . : . : . :
JMFS165A05+ CACAGATGCTGTGTCTGAAAATGGCACGGGATGAACCTTTTTTCCACGTCCCATAAATGG
JMFS096H05+ CACAGATGCTGTGTCTGAAAATGGCACGGGATGAACCTTTTTTCCACGTCCCATAAATGG
JMFS100C05+ CACAGATGCTGTGTCTGAAAATGGCACGGGATGAACCTTTTTTCCACGTCCCATAAATGG
JMFS057F03+ CACAGATGCTGTGTCTGAAAATGGCACGGGATGAACCTTTTTTCCACGTCCCATAAATGG
                      ____________________________________________________________
consensus CACAGATGCTGTGTCTGAAAATGGCACGGGATGAACCTTTTTTCCACGTCCCATAAATGG
 
. : . : . : . : . : . :
JMFS165A05+ AGGGATAATAAGAGCATGCTT
JMFS096H05+ AGGGATAATAAGAGCATGCTTGTCAGCTGAAATTCCATCGTCCTCTTCACCATAGGTAAG
JMFS100C05+ AGGGATAATAAGAGCATGCTTGTCAGCTGAAATTCCATCGTCCTCTTCACCATAGGTAAG
JMFS057F03+ AGGGATAATAAGAGCATGCTTGTCAGCTGAAATTCCATCGTCCTCTTCACCATAGGTAAG
JMFS077F01+ AGGGATAATAAGAGCATGCTTGTCAGCTGAAATTCCATCGTCCTCTTCACCATAGGTAAG
JMFS015D01+ CATAGGTAAG
JMFF050A17+ CATAGGTAAG
JMFS147D09+ TCACCATAGGTAAG
JMFF041P23+ CTTCACCATAGGTAAG
                      ____________________________________________________________
consensus AGGGATAATAAGAGCATGCTTGTCAGCTGAAATTCCATCGTCCTCTTCACCATAGGTAAG
 
. : . : . : . : . : . :
JMFS096H05+ GAGCGGGATTTCTGAGGGATCTGCTTCCGATGGT
JMFS100C05+ GAGCGGGATTTCTGAGGGATCTGCTTCCGATGGTGTCATGATCCCAGAACCGTTAACACC
JMFS057F03+ GAGCGGGATTTCTGAGGGATCTGCTTCCGATGGTGTCATGATCCCAGAACCGTTAACACC
JMFS077F01+ GAGCGGGATTTCTGAGGGATCTGCTTCCGATGGTGTCATGATCCCAGAACCGTTAACACC
JMFS015D01+ GAGCGGGATTTCTGAGGGATCTGCTTCCGATGGTGTCATGATCCCAGAACCGTTAACACC
JMFF050A17+ GAGCGGGATTTCTGAGGGATCTGCTTCCGATGGTGTCATGATCCCAGAACCGTTAACACC
JMFS147D09+ GAGCGGGATTTCTGAGGGATCTGCTTCCGATGGTGTCATGATCCCAGAACCGTTAACACC
JMFF041P23+ GAGCGGGATTTCTGAGGGATCTGCTTCCGATGGTGTCATGATCCCAGAACCGTTAACACC
                      ____________________________________________________________
consensus GAGCGGGATTTCTGAGGGATCTGCTTCCGATGGTGTCATGATCCCAGAACCGTTAACACC
 
. : . : . : . : . : . :
JMFS100C05+ ATAACCAACATTAAGGCGAGCAGCCAGTGCTGCCTCAGCAACGTGGTGAGGATCTCTTCT
JMFS057F03+ ATAACCAACATTAAGGCGAGCAGCCAGTGCTGCCTCAGCAACGTGGTGAGGATCTCTTCT
JMFS077F01+ ATAACCAACATTAAGGCGAGCAGCCAGTGCTGCCTCAGCAACGTGGTGAGGATCTCTTCT
JMFS015D01+ ATAACCAACATTAAGGCGAGCAGCCAGTGCTGCCTCAGCAACGTGGTGAGGATCTCTTCT
JMFF050A17+ ATAACCAACATTAAGGCGAGCAGCCAGTGCTGCCTCAGCAACGTGGTGAGGATCTCTTCT
JMFS147D09+ ATAACCAACATTAAGGCGAGCAGCCAGTGCTGCCTCAGCAACGTGGTGAGGATCTCTTCT
JMFF041P23+ ATAACCAACATTAAGGCGAGGAGCCAGTGCTGCCTCAGCAACGTGGTGAGGATCTCTTCT
JMFS092G08+ GCCTCAGCAACGTGGTGAGGATCTCTTCT
                      ____________________________________________________________
consensus ATAACCAACATTAAGGCGAGCAGCCAGTGCTGCCTCAGCAACGTGGTGAGGATCTCTTCT
 
. : . : . : . : . : . :
JMFS057F03+ TACACTGCTATTATAATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
JMFS077F01+ TACACTGCTATTATAATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
JMFS015D01+ TACACTGCTATTATAATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
JMFF050A17+ TACACTGCTATTATAATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
JMFS147D09+ TACACTGCTATTATAATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
JMFF049M13+ ATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
JMFF041P23+ TACACTGCTATTATAATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
JMFS092G08+ TACACTGCTATTATAATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
JMSF046D10+ TACACTGCTATTATAATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
                      ____________________________________________________________
consensus TACACTGCTATTATAATCGAACTCATGGTCAAGATCATCAAAATCATCCTCTTCTTCATC
 
. : . : . : . : . : . :
JMFS057F03+ TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
JMFS077F01+ TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
JMFS015D01+ TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
JMFF050A17+ TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
JMFS147D09+ TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
JMFF049M13+ TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
JMFF041P23+ TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
JMFF001E13+ TTCAACTGTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
JMFS092G08+ TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
JMFS164E05+ TCCCTTTTAAGCGCTTGTACNTAGTTTTGCACTGAGGACAAGC
JMSF046D10+ TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
                      ____________________________________________________________
consensus TCCTTCAACTCTAGGACTCCCTTTTAAGCGCTTGTACCTAGTTTTGCACTGAGGACAAGC
 
. : . : . : . : . : . :
JMFS057F03+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMFS077F01+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMFS015D01+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMFF050A17+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMFS147D09+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMFF049M13+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMFF041P23+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMFF001E13+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMFS092G08+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMFS164E05+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
JMSF046D10+ TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
                      ____________________________________________________________
consensus TTGATTGCCTTCCCTCCTTTCATACTCATAACAGGGTCGACAAACAGGGAATGCACATTC
 
. : . : . : . : . : . :
JMFS057F03+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCA
JMFS077F01+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMFS015D01+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMFF050A17+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMFS147D09+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMFF049M13+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMFF041P23+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMFF001E13+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMFS092G08+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMFS164E05+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMSF046D10+ ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
JMFS098C12+ TCATCTCCACAAATCTG
JMFS112G02+ CAAATCTG
                      ____________________________________________________________
consensus ATTGCAAGCAACGAATGGCTCCCCGTCAACTGTAATTTCAATCTCATCTCCACAAATCTG
 
. : . : . : . : . : . :
JMFS077F01+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFS015D01+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFF050A17+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFS147D09+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFF049M13+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATGTCATCAGCATTGAT
JMFF041P23+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFF001E13+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFS092G08+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFS164E05+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMSF046D10+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFS098C12+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFS112G02+ ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
JMFS078A06+ CACTCAATTCCTTANCAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
                      ____________________________________________________________
consensus ACAACTCTGTCCACTCAATTCCTTTACAGAAGTAACTCTTCCAATCTCATCAGCATTGAT
 
. : . : . : . : . : . :
JMFS077F01+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFS015D01+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFF050A17+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFS147D09+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFF049M13+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFF041P23+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFF001E13+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFS092G08+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFS164E05+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMSF046D10+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFS098C12+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFS112G02+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFF004E07+ TTTGGTGTCCATTTG
JMFS078A06+ GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
JMFF007G16+ TGTCCATTTG
                      ____________________________________________________________
consensus GAGTACAAACTCATTCCTATTGTGCGAACCAGCAATAAGCCTTCCTTTGGTGTCCATTTG
 
. : . : . : . : . : . :
JMFS077F01+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFS015D01+ ACTCCAACACCACCTTCACAA
JMFF050A17+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFS147D09+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFF049M13+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACGC
JMFF041P23+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFF001E13+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFS092G08+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFS164E05+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMSF046D10+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFS098C12+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFS112G02+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFF004E07+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFS078A06+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFF021J17+ CTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
JMFF007G16+ ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
                      ____________________________________________________________
consensus ACTCCAACACCACCTTCACAATAATGAAACAGATAAAAAGACCCACTTCTGTCTTTACAC
 
. : . : . : . : . : . :
JMFS077F01+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAA
JMFF050A17+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFS147D09+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFF049M13+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFF041P23+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFF001E13+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFS092G08+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFS164E05+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMSF046D10+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFS098C12+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFS112G02+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFF004E07+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFS078A06+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFF021J17+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
JMFF007G16+ TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
                      ____________________________________________________________
consensus TTAAATCCGCAGCACCCACTCAAAGAAACCCATTGCAGAGATCAGTCAAAGAAAAGCGCT
 
. : . : . : . : . : . :
JMFF050A17+ GCCTTTTCTTCGTCTTCTTCTTCCCC
JMFS147D09+ GCCTTT
JMFF049M13+ GCCTTTTCGTCGTCTTCGTCTTC
JMFF041P23+ GCCTTTTCTTCGTCTTCTTCTTCCCCT
JMFF001E13+ GCCTTTTCTTCGTCTTCTTCTTCCCCT
JMFS092G08+ GCCTTTTCTTCGTCTTCTTCTTCCCCTTCTCCAACTCTTGCTTGGGCCAATGCTCTTAAA
JMFS164E05+ GCCTTTTCTTCGTCTTCTTCTTCCCCTTCTCCAACTCTTGCTTGGGCCAATGCTCTTAAA
JMSF046D10+ GCCTTTTCTTCGTCTTCTTCTTCCCCTTCTCCAACTCTTGCTTGGGCCAATGCTCTTAAA
JMFS098C12+ GCCTTTTCTTCGTCTTCTTCTTCCCCTTCTCCAACTCTTGCTTGGGCCAATGCTCTTAAA
JMFS112G02+ GCCTTTTCTTCGTCTTCTTCTTCCCCTTCTCCAACTCTTGCTTGGGCCAATGCTCTTAAA
JMFF004E07+ GCCTTTTCTTCGTCTTCTTCTTCCCCT
JMFS078A06+ GCCTTTTCTTCGTCTTCTTCTTCCCCTTCTCCAACTCTTGCTTGGGCCAATGCTCTTAAA
JMFF021J17+ GCCTTTTCTTCGTCTTCTTCTTCCCCTTCTCCAACTCTTGCTTGGGCCAATGCTCTTAAA
JMFF007G16+ GCCTTTTCTTCGTCTTCTTCTTCCCCTTCTCCAACTCTTGCTTGGGCCAATGCTCTTAAA
                      ____________________________________________________________
consensus GCCTTTTCTTCGTCTTCTTCTTCCCCTTCTCCAACTCTTGCTTGGGCCAATGCTCTTAAA
 
. : . : . : . : . : . :
JMFS092G08+ CACCAATAACAGGTGAAAACGACGTACAATCACAGAAATACAGACACAAATGAT
JMFS164E05+ CACCAATAACAGGTGAAAACGACGTACAATCACAGAAATACAGACACAAATGATATTGTA
JMSF046D10+ CACCAATAACAGGTGAAAACGACGTACAATCACAGAAATACAGACACAAATGATATTGTA
JMFS098C12+ CACCAATAACAGGTGAAAACGACGTACAATCACAGAAATACAGACACAAATGATATTGTA
JMFS112G02+ CACCAATAACAGGTGAAAACGACGTACAATCACAGAAATACAGACACAAATGATATTGTA
JMFS078A06+ CACCAATAACAGGTGAAAACGACGTACAATCACAGAAATACAGACACAAATGATATTGTA
JMFF021J17+ CACCAATAACAGGTGAAAACGACGTACAATCACAGAAATACAGACACAAATGATATTGTA
JMFF007G16+ CACCAATAACAGGTGAAAACGACGTACAATCACAGAAATACAGACACAAATGATATTGTA
                      ____________________________________________________________
consensus CACCAATAACAGGTGAAAACGACGTACAATCACAGAAATACAGACACAAATGATATTGTA
 
. : . : . : . : . : . :
JMFS164E05+ TTTTATTTTAAAAATATATATATAGGTGGGTATATATGAATGTATTATCCCGTATATAAT
JMSF046D10+ TTTTATTTTAAAAATATATATATAGGTGGGTATATATGAATGTATTATCCCGTATATAAT
JMFS098C12+ TTTTATTTTAAAAATATATATATAGGTGGGTATATATGAATGTATTATCCCGTATATAAT
JMFS112G02+ TTTTATTTTAAAAATATATATATAGGTGGGTATATATGAATGTATTATCCCGTATATAAT
JMFS078A06+ TTTTATTTTAAAAATATATATATAGGTGGGTATATATGAATGTATTATCCCGTATATAAT
JMFF021J17+ TTTTATTTTAAAAATATATATATAGGTGGGTATATATGAATGTATTATCCCGTATATAAT
JMFF007G16+ TTTTATTTTAAAAATATATATATAGGTGGGTATATATGAATGTATTATCCCGTATATAAT
                      ____________________________________________________________
consensus TTTTATTTTAAAAATATATATATAGGTGGGTATATATGAATGTATTATCCCGTATATAAT
 
. : . : . : . : . : . :
JMFS164E05+ AAGGGAGATGATTCCTTTCTTGAGAGAAACCCGGTGGGGGATA
JMSF046D10+ AAGGGAGATGATTCCTTTCTTGAGAGAAACCCGGTGGGGGATAGTGGGTTTCTCTCTTGG
JMFS098C12+ AAGGGAGATGATTCCTTTCTTGAGAGAAACCCGGTGGGGGATAGTGGGTTTCTCTCTTGG
JMFS112G02+ AAGGGAGATGATTCCTTTCTTGAGAGAAACCCGGTGGGGGATAGTGGGTTTCTCTCTTGG
JMFS078A06+ AAGGGAGATGATTCCTTTCTTGAGAGAAACCCGGTGGGGGATAGTGGGTTTCTCTCTTGG
JMFF021J17+ AAGGGAGATGATTCCTTTCTTGAGAGAAACCCGGTGGGGGATAGTGGGTTTCTCTCTTGG
JMFF007G16+ AAGGGAGATGATTCCTTTCTTGAGAGAAACCCGGTGGGGGATAGTGGGTTTCTCTCTTGG
                      ____________________________________________________________
consensus AAGGGAGATGATTCCTTTCTTGAGAGAAACCCGGTGGGGGATAGTGGGTTTCTCTCTTGG
 
. : . : . : . : . : . :
JMSF046D10+ TGAGCTGTGGGTGGCGTGGGATC
JMFS098C12+ TGAGCTGTGGGTGGCGTGGGATCAGAGAATCAAAGCCCCCCCACGGGAGTTGAAGAACAA
JMFS112G02+ TGAGCTGTGGGTGGCGTGGGATCAGAGAATCAAAGCCCCCCCACGGGAGTTGAAGAACAA
JMFS078A06+ TGAGCTGTGGGTGGCGTGGGATCAGAGAATCAAAGCCCCCCCACGGGAGTTGAAGAACAA
JMFF021J17+ TGAGCTGTGGGTGGCGTGGGATCAGAGAATCAAAGCCCCCCCACGGGAGTTGAAGAACAA
JMFF007G16+ TGAGCTGTGGGTGGCGTGGGATCAGAGAATCAAAGCCCCCCCACGGGAGTTGAAGAACAA
                      ____________________________________________________________
consensus TGAGCTGTGGGTGGCGTGGGATCAGAGAATCAAAGCCCCCCCACGGGAGTTGAAGAACAA
 
. : . : . : . : . : . :
JMFS098C12+ CAAAGGGATCGACAAAGACAAGTAGAGAGAGAAAGTGAGGTCTACTGTGAGAAAGTTAGA
JMFS112G02+ CAAAGGGATCGACAAAGACAAGTAGAGAGAGAAAGTGAGGTCTACTGTGAGAAAGTTAGA
JMFS078A06+ CAAAGGGATCGACAAAGACAAGTAGAGAGAGAAAGTGAGGTCTACTGTGAGAAAGTTAGA
JMFF021J17+ CAAAGGGATCGACAAAGACAAGTAGAGAGAGAAAGTGAGGTCTACTGTGAGAAAGTTAGA
JMFF007G16+ CAAAGGGATCGACAAAGACAAGTAGAGAGAGAAAGTGAGGTCTACTGTGAGAAAGTTAGA
                      ____________________________________________________________
consensus CAAAGGGATCGACAAAGACAAGTAGAGAGAGAAAGTGAGGTCTACTGTGAGAAAGTTAGA
 
. : . : . : . : . : . :
JMFS098C12+ GAGAGAGAGA
JMFS112G02+ GAGAGAGAGAGA
JMFS078A06+ GAGAGAGAGAGAGAGAGAAAAAGAGGGCATCGAAAGT
JMFF021J17+ GAGAGAGAGAGAGAGAGAAAAAGAGGGCATCGAAAGTTCAACGCTTAGTTGAGAAGGGAC
JMFF007G16+ GAGAGAGAGAGAGAGAGAAAAAGAGGGCATCGAAAGTTCAACGCTTAGTTGAGAAGGGAC
                      ____________________________________________________________
consensus GAGAGAGAGAGAGAGAGAAAAAGAGGGCATCGAAAGTTCAACGCTTAGTTGAGAAGGGAC