Previous Contig 000370:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007E08Sequence494000370 (2)gb:AP001309_18211337e-47Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUO10.766009773 (3)
JMFF033I18Sequence553000370 (2)gb:AP001309_18211339e-47Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUO10.737009773 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF033I18+ AGGTACAATTCCT
                      ____________________________________________________________
consensus AGGTACAATTCCT
 
. : . : . : . : . : . :
JMFF033I18+ TGAGAAACATTACTGTCCATACCAGGAGCAGTAACTGAGGGAACTGCTGGTACAGATACA
JMFF007E08+ CTGGTACAGATACA
                      ____________________________________________________________
consensus TGAGAAACATTACTGTCCATACCAGGAGCAGTAACTGAGGGAACTGCTGGTACAGATACA
 
. : . : . : . : . : . :
JMFF033I18+ CCTGTACTTGCTGCATTCAAATTAGCAGCTTGAAAATTATTTGCTTCCAACTCATTTCCC
JMFF007E08+ CCTGTACTTGCTGCATTCAAATTAGCAGCTTGAAAATTATTTGCTTCCAACTCATTTCCC
                      ____________________________________________________________
consensus CCTGTACTTGCTGCATTCAAATTAGCAGCTTGAAAATTATTTGCTTCCAACTCATTTCCC
 
. : . : . : . : . : . :
JMFF033I18+ AAACTCTTACTTCCAGCCAATAGCTGTGGTGGGGGTGGAACAGCACCATAGACTTTAGAA
JMFF007E08+ AAACTCTTACTTCCAGCCAATAGCTGTGGTGGGGGTGGAACAGCACCATAGACTTTAGAA
                      ____________________________________________________________
consensus AAACTCTTACTTCCAGCCAATAGCTGTGGTGGGGGTGGAACAGCACCATAGACTTTAGAA
 
. : . : . : . : . : . :
JMFF033I18+ GAAGACACCCTAGAAGTACCAAACTCGGCAGCTATGGTATCCAACAGATTTTCTGCCAAA
JMFF007E08+ GAAGACACCCTAGAAGTACCAAACTCGGCAGCTATGGTATCCAACAGATTTTCTGCCAAA
                      ____________________________________________________________
consensus GAAGACACCCTAGAAGTACCAAACTCGGCAGCTATGGTATCCAACAGATTTTCTGCCAAA
 
. : . : . : . : . : . :
JMFF033I18+ AGCTTTGCACGCTCGAGACTTTTTGGATTATTGCTTGATAGGAACAAATGCAGTGGTTGA
JMFF007E08+ AGCTTTGCACGCTCGAGACTTTTTGGATTATTGCTTGATAGGAACAAATGCAGTGGTTGA
                      ____________________________________________________________
consensus AGCTTTGCACGCTCGAGACTTTTTGGATTATTGCTTGATAGGAACAAATGCAGTGGTTGA
 
. : . : . : . : . : . :
JMFF033I18+ TTTGCATCTTCACCCTGTACAGGTTCGGAATCTCCTGAACCATGCCCTCTTAACACAACA
JMFF007E08+ TTTGCATCTTCACCCTGTACAGGTTCGGAATCTCCTGAACCATGCCCTCTTAACACAACA
                      ____________________________________________________________
consensus TTTGCATCTTCACCCTGTACAGGTTCGGAATCTCCTGAACCATGCCCTCTTAACACAACA
 
. : . : . : . : . : . :
JMFF033I18+ GTTGCTCCTGTTTCATTCATAATGTGATTTACATACTGGTCATTTGGTCCTCGAATACGA
JMFF007E08+ GTTGCTCCTGTTTCATTCATAATGTGATTTACATACTGGTCATTTGGTCCTCGAATACGA
                      ____________________________________________________________
consensus GTTGCTCCTGTTTCATTCATAATGTGATTTACATACTGGTCATTTGGTCCTCGAATACGA
 
. : . : . : . : . : . :
JMFF033I18+ GCAGCAATATTCAAGGATGTTTCAGCCTCAAAGCCCACATAGACACAGGTACTCATGGAG
JMFF007E08+ GCAGCAATATTCAAGGATGTTTCAGCCTCAAAGCCCACATAGACACAGGTACTCATGGAG
                      ____________________________________________________________
consensus GCAGCAATATTCAAGGATGTTTCAGCCTCAAAGCCCACATAGACACAGGTACTCATGGAG
 
. : . : . : . : . : . :
JMFF033I18+ GGATTAACCTTCAATCCATTGTTCACTGAACCCTCTTTCAGCATTTCCTCCACGATTGCT
JMFF007E08+ GGATTAACCTTCAATCCATTGTTCACTGAACCCTCTTTCAGCATTTCCTCCACGATTGCT
                      ____________________________________________________________
consensus GGATTAACCTTCAATCCATTGTTCACTGAACCCTCTTTCAGCATTTCCTCCACGATTGCT