Previous Contig 000367:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007D10Sequence421000367 (2)198008485 (2)
JMFF014J17Sequence421000367 (2)223008485 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007D10+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMFF014J17+ TTTTTCTCTCAGTCTATACTTTTCTGACTCTGAACTCCCACCTTTTCATATCTTAT
JMFF007D10+ TNTNTTTTTCTCTCAGTCTATACTTTTCTGACTCTGAACTCCCACCTTTTCATATCTTAT
                      ____________________________________________________________
consensus TNTNTTTTTCTCTCAGTCTATACTTTTCTGACTCTGAACTCCCACCTTTTCATATCTTAT
 
. : . : . : . : . : . :
JMFF014J17+ GCTATCTAAATTTAATGCGAAACTCAAAGACTATACAAAAATAACAGAATTTACGAGGAA
JMFF007D10+ GCTATCTAAATTTAATGCGAAACTCAAAGACTATACAAAAATAACAGAATTTACGAGGAA
                      ____________________________________________________________
consensus GCTATCTAAATTTAATGCGAAACTCAAAGACTATACAAAAATAACAGAATTTACGAGGAA
 
. : . : . : . : . : . :
JMFF014J17+ AAAGAACAAAATAAAAGTCCTTCAAAACTCAATCAGCAGAAATTCACAAGATTTTGAATG
JMFF007D10+ AAAGAACAAAATAAAAGTCCTTCAAAACTCAATCAGCAGAAATTCACAAGATTTTGAATG
                      ____________________________________________________________
consensus AAAGAACAAAATAAAAGTCCTTCAAAACTCAATCAGCAGAAATTCACAAGATTTTGAATG
 
. : . : . : . : . : . :
JMFF014J17+ TAGTTGCTATGTCCATGCACAAACACACATGCATATACACACACACTATATAAGCGCGCG
JMFF007D10+ TAGTTGCTATGTCCATGCACAAACACACATGCATATACACACACACTATATAAGCGCGCG
                      ____________________________________________________________
consensus TAGTTGCTATGTCCATGCACAAACACACATGCATATACACACACACTATATAAGCGCGCG
 
. : . : . : . : . : . :
JMFF014J17+ GTTTTTAGAATTTGAAATTAAGAGCGATCATTTAACAAAACCACTAAGAAATCAAAGAAT
JMFF007D10+ GTTTTTAGAATTTGAAATTAAGAGCGATCATTTAACAAAACCACTAAGAAATCAAAGAAT
                      ____________________________________________________________
consensus GTTTTTAGAATTTGAAATTAAGAGCGATCATTTAACAAAACCACTAAGAAATCAAAGAAT
 
. : . : . : . : . : . :
JMFF014J17+ TGAAATCAAATTCAAGTCGAACAGGTTGAAGCTTAGAGCGATGTTACCAATCGCGAACTT
JMFF007D10+ TGAAATCAAATTCAAGTCGAACAGGTTGAAGCTTAGAGCGATGTTACCAATCGCGAACTT
                      ____________________________________________________________
consensus TGAAATCAAATTCAAGTCGAACAGGTTGAAGCTTAGAGCGATGTTACCAATCGCGAACTT
 
. : . : . : . : . : . :
JMFF014J17+ GAATTTGCAGAATCAAAATCTGTAACCTTATTAGGGTTCAGCCATTGTCCGCACAA
JMFF007D10+ GAATTTGCAGAATCAAAATCTGTAACCTTATTAGGGTTCAGCCATTGTCCGCACAAGAAC
                      ____________________________________________________________
consensus GAATTTGCAGAATCAAAATCTGTAACCTTATTAGGGTTCAGCCATTGTCCGCACAAGAAC