Previous Contig 000350:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006O09Sequence592000350 (3)gb:AF506028_18068503e-53Poncirus trifoliata citrus tristeza virus resistance gene locus, complete sequen774008468 (2)gb:AF506028_18068502e-77Poncirus trifoliata citrus tristeza virus resistance gene locus, complete sequen
JMFF045M24Sequence643000350 (3)gb:AF506028_18068502e-65Poncirus trifoliata citrus tristeza virus resistance gene locus, complete sequen
JMSF042K23Sequence755000350 (3)gb:AF506028_18068501e-47Poncirus trifoliata citrus tristeza virus resistance gene locus, complete sequen681008468 (2)gb:AF506028_18068501e-57Poncirus trifoliata citrus tristeza virus resistance gene locus, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042K23+ ACTAATAAATACAGCAAATTAAGGTGGAAAAAACTGATTACTAATCC
                      ____________________________________________________________
consensus ACTAATAAATACAGCAAATTAAGGTGGAAAAAACTGATTACTAATCC
 
. : . : . : . : . : . :
JMSF042K23+ TAAACAAGTAAATAAAAGCCNTAAATCAGAATTCAGTAAATCAAGACAATTGAATTGAAG
                      ____________________________________________________________
consensus TAAACAAGTAAATAAAAGCCNTAAATCAGAATTCAGTAAATCAAGACAATTGAATTGAAG
 
. : . : . : . : . : . :
JMSF042K23+ CAAGACAGAGGTATAAACTACAGGCAATGAAATCCGAAAAAGGGAAAGTAGAAAGTGCAG
                      ____________________________________________________________
consensus CAAGACAGAGGTATAAACTACAGGCAATGAAATCCGAAAAAGGGAAAGTAGAAAGTGCAG
 
. : . : . : . : . : . :
JMSF042K23+ AAAAGATTCAATCTTTGAGATGAGAAAGGGAAATAAAAGAGCTCACAAGCCAGTAAGGCA
JMFF045M24+ AAGCCAGTAAGGCA
JMFF006O09+ AAGCCAGTAAGGCA
                      ____________________________________________________________
consensus AAAAGATTCAATCTTTGAGATGAGAAAGGGAAATAAAAGAGCTCACAAGCCAGTAAGGCA
 
. : . : . : . : . : . :
JMSF042K23+ AGGATTGAACAGTCTGGCTAACAACAAGCCAAAGAACGCCATAGCCCAGAAAAGCACAAG
JMFF045M24+ AGGATTGAACAGTCTGGCTAACAACAAGCCAAAGAACGCCATAGCCCAGAAAAGCACAAG
JMFF006O09+ AGGATTGAACAGTCTGGCTAACAACAAGCCAAAGAACGCCATAGCCCAGAAAAGCACAAG
                      ____________________________________________________________
consensus AGGATTGAACAGTCTGGCTAACAACAAGCCAAAGAACGCCATAGCCCAGAAAAGCACAAG
 
. : . : . : . : . : . :
JMSF042K23+ CAGCGCCAACAAGAAGCACAGCCCAGGGAGGGAACTTATTGCAGGCTATCCCTGGAAGAA
JMFF045M24+ CAGCGCCAACAAGAAGCACAGCCCAGGGAGGGAACTTATTGCAGGCTATCCCTGGAAGAA
JMFF006O09+ CAGCGCCAACAAGAAGCACAGCCCAGGGAGGGAACTTATTGCAGGCTATCCCTGGAAGAA
                      ____________________________________________________________
consensus CAGCGCCAACAAGAAGCACAGCCCAGGGAGGGAACTTATTGCAGGCTATCCCTGGAAGAA
 
. : . : . : . : . : . :
JMSF042K23+ TCCCCACATTTTCCCCAATATCATTGGCCACTCCAAGAATGGTGAGCTGCTGCTGACTGA
JMFF045M24+ TCCCCACATTTTCCCCAATATCATTGGCCACTCCAAGAATGGTGAGCTGCTGCTGACTGA
JMFF006O09+ TCCCCACATTTTCCCCAATATCATTGGCCACTCCAAGAATGGTGAGCTGCTGCTGACTGA
                      ____________________________________________________________
consensus TCCCCACATTTTCCCCAATATCATTGGCCACTCCAAGAATGGTGAGCTGCTGCTGACTGA
 
. : . : . : . : . : . :
JMSF042K23+ AACCCAGCACTGATTTCAGAGAAGGAGAGTAGAGAGGGAAAGTGTAAGCGTTCCCGGCGG
JMFF045M24+ AACCCAGCACTGATTTCAGAGAAGGAGAGTAGAGAGGGAAAGTGTAAGCGTTCCCGGCGG
JMFF006O09+ AACCCAGCACTGATTTCAGAGAAGGAGAGTAGAGAGGGAAAGTGTAAGCGTTCCCGGCGG
                      ____________________________________________________________
consensus AACCCAGCACTGATTTCAGAGAAGGAGAGTAGAGAGGGAAAGTGTAAGCGTTCCCGGCGG
 
. : . : . : . : . : . :
JMSF042K23+ CGATTTGAACCCAAACCGCCGCTCCAAGACCCACCCACGGTGGTCTACTCCCTTCTTTTA
JMFF045M24+ CGATTTGAACCCAAACCGCCGCTCCAAGACCCACCCACGGTGGTCTACTCCCTTCTTTTA
JMFF006O09+ CGATTTGAACCCAAACCGCCGCTCCAAGACCCACCCACGGTGGTCTACTCCCTTCTTTTA
                      ____________________________________________________________
consensus CGATTTGAACCCAAACCGCCGCTCCAAGACCCACCCACGGTGGTCTACTCCCTTCTTTTA
 
. : . : . : . : . : . :
JMSF042K23+ GAACCACCATTCTTTTCCCACACTGTTCTTCTTGATTAACCTATGCTTCAGCTCTCCGGT
JMFF045M24+ GAACCACCATTCTTTTCCCACACTGTTCTTCTTGATTAACCTATGCTTCAGCTCTCCGGT
JMFF006O09+ GAACCACCATTCTTTTCCCACACTGTTCTTCTTGATTAACCTATGCTTCAGCTCTCCGGT
                      ____________________________________________________________
consensus GAACCACCATTCTTTTCCCACACTGTTCTTCTTGATTAACCTATGCTTCAGCTCTCCGGT
 
. : . : . : . : . : . :
JMSF042K23+ TCTTGAGGTTTGATTAAATTGACGATTCTCAAGCCTCAAGTTCTTCTCCCTAAGGGGGAC
JMFF045M24+ TCTTGAGGTTTGATTAAATTGACGATTCTCAAGCCTCAAGTTCTTCTCCCTAAGGGGGAC
JMFF006O09+ TCTTGAGGTTTGATTAAATTGACGATTCTCAAGCCTCAAGTTCTTCTCCCTAAGGGGGAC
                      ____________________________________________________________
consensus TCTTGAGGTTTGATTAAATTGACGATTCTCAAGCCTCAAGTTCTTCTCCCTAAGGGGGAC
 
. : . : . : . : . : . :
JMSF042K23+ AAGGGTATATTTAGATATTAACTAGCCACTGTATTGGAATATGAATTCTCCTTTTTCTTT
JMFF045M24+ AAGGGTATATTTAGATATTAACTAGCCACTGTATTGGAATATGAATTCTCCTTTTTCTTT
JMFF006O09+ AAGGGTATATTTAGATATTAACTAGCCACTGTATTGGAATATGAATTCTCCTTTTTCTTT
                      ____________________________________________________________
consensus AAGGGTATATTTAGATATTAACTAGCCACTGTATTGGAATATGAATTCTCCTTTTTCTTT
 
. : . : . : . : . : . :
JMSF042K23+ CTTTGTTTTAGTCTCTCTGGTGGTAGGTGTTCCAACTGCCAAGAGAT
JMFF045M24+ CTTTGTTTTAGTCTCTCTGGTGGTAGGTGTTCCAACTGCCAAGAGAT
JMFF006O09+ CTTTGTTTTAGTCTCTCTGGTGGTAGGTGTTCCAACTGCCAAGAGATGTGGATGAAGAAT
                      ____________________________________________________________
consensus CTTTGTTTTAGTCTCTCTGGTGGTAGGTGTTCCAACTGCCAAGAGATGTGGATGAAGAAT