Previous Contig 000348:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006N16Sequence567000348 (2)gb:AF211538_17773981e-16Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 180 (ACRE180) mRNA, complet560000348 (2)gb:AF211538_17773981e-16Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 180 (ACRE180) mRNA, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006N16+ GCGCTTCGCTTGCAAGCAACCGCAATG
JMFF006N16- GCGCTTCGCTTGCAAGCAACCGCAATG
                      ____________________________________________________________
consensus GCGCTTCGCTTGCAAGCAACCGCAATG
 
. : . : . : . : . : . :
rJMFF006N16+ TTGAAAGCGCCAGGCTACTTGTTCGCCTTCAATAGGCCGAACAAGAAGGCTTCCGGCAGA
JMFF006N16- TTGAAAGCGCCAGGCTACTTGTTCGCCTTCAATAGGCCGAACAAGAAGGCTTCCGGCAGA
                      ____________________________________________________________
consensus TTGAAAGCGCCAGGCTACTTGTTCGCCTTCAATAGGCCGAACAAGAAGGCTTCCGGCAGA
 
. : . : . : . : . : . :
rJMFF006N16+ GGTTCCGACGACGCCGGCGGCGCAATGAGTGGTAAAAGCAGCGGTGCTACTAACAATTCG
JMFF006N16- GGTTCCGACGACGCCGGCGGCGCAATGAGTGGTAAAAGCAGCGGTGCTACTAACAATTCG
                      ____________________________________________________________
consensus GGTTCCGACGACGCCGGCGGCGCAATGAGTGGTAAAAGCAGCGGTGCTACTAACAATTCG
 
. : . : . : . : . : . :
rJMFF006N16+ AGGCTGCGGCGCTGGAGATTATTGAAGCGCATATCTCCAGGGTTGCGGTGGAAGAGGATG
JMFF006N16- AGGCTGCGGCGCTGGAGATTATTGAAGCGCATATCTCCAGGGTTGCGGTGGAAGAGGATG
                      ____________________________________________________________
consensus AGGCTGCGGCGCTGGAGATTATTGAAGCGCATATCTCCAGGGTTGCGGTGGAAGAGGATG
 
. : . : . : . : . : . :
rJMFF006N16+ TTAAACCTCCATGTCTGGTTCGTGGACAGTGTACTTTTCAAGATAGTTTCTGTTTTCGAG
JMFF006N16- TTAAACCTCCATGTCTGGTTCGTGGACAGTGTACTTTTCAAGATAGTTTCTGTTTTCGAG
                      ____________________________________________________________
consensus TTAAACCTCCATGTCTGGTTCGTGGACAGTGTACTTTTCAAGATAGTTTCTGTTTTCGAG
 
. : . : . : . : . : . :
rJMFF006N16+ GCCGTCGTTTTGATCTCAACGCTTGCTTTCTTCTACCTCTTCTGCGGATGCCATATATGA
JMFF006N16- GCCGTCGTTTTGATCTCAACGCTTGCTTTCTTCTACCTCTTCTGCGGATGCCATATATGA
                      ____________________________________________________________
consensus GCCGTCGTTTTGATCTCAACGCTTGCTTTCTTCTACCTCTTCTGCGGATGCCATATATGA
 
. : . : . : . : . : . :
rJMFF006N16+ ATGAAGAAGGAATTGAAATAGCGTTCATCACTTCATCCGGCCTGCCGAAATCTATGCAGT
JMFF006N16- ATGAAGAAGGAATTGAAATAGCGTTCATCACTTCATCCGGCCTGCCGAAATCTATGCAGT
                      ____________________________________________________________
consensus ATGAAGAAGGAATTGAAATAGCGTTCATCACTTCATCCGGCCTGCCGAAATCTATGCAGT
 
. : . : . : . : . : . :
rJMFF006N16+ TTTAAGTAAGTTTGTAAATGTAACTGCCGTTTACAACTTGATGCTCCTCTTCTTTCTGAA
JMFF006N16- TTTAAGTAAGTTTGTAAATGTAACTGCCGTTTACAACTTGATGCTCCTCTTCTTTCTGAA
                      ____________________________________________________________
consensus TTTAAGTAAGTTTGTAAATGTAACTGCCGTTTACAACTTGATGCTCCTCTTCTTTCTGAA
 
. : . : . : . : . : . :
rJMFF006N16+ ATTTATGTAAATTTTTTATTGATTTCCTATTTAAAAAAAGGAAATTATATTTTATAGTTT
JMFF006N16- ATTTATGTAAATTTTTTATTGATTTCCTATTTAAAAAAAGGAAATTATATTTTATAGTTT
                      ____________________________________________________________
consensus ATTTATGTAAATTTTTTATTGATTTCCTATTTAAAAAAAGGAAATTATATTTTATAGTTT
 
. : . : . : . : . : . :
rJMFF006N16+ ATTTTCATTTACTTTTGTGTAATTGTG-TTTGAAAGGAATGACTATTTACAGAT
JMFF006N16- ATTTTCATTTACTTTTGTGTAATTGTGTTTTGAAAGGAATGACTATTTACAGATGTGGAA
                      ____________________________________________________________
consensus ATTTTCATTTACTTTTGTGTAATTGTGTTTTGAAAGGAATGACTATTTACAGATGTGGAA