Previous Contig 000345:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006M22Sequence605000345 (3)pir|D84649|D846492e-43hypothetical protein At2g25520 [imported] - Arabidopsis thaliana>gb:AC006300_153210008808 (3)
JMFF013D07Sequence574000345 (3)pir|T05349|T053493e-63hypothetical protein F8B4.90 - Arabidopsis thaliana>gb:ATCHRIV77_1547159 Arabido531008808 (3)gb:ATF2I11_15504711e-06Arabidopsis thaliana DNA chromosome 5, BAC clone F2I11 (ESSA project).
JMFF023K07Sequence536000345 (3)pir|D84649|D846497e-31hypothetical protein At2g25520 [imported] - Arabidopsis thaliana>gb:AC006300_153331008808 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF013D07+ CTCGTCGTACGCGGCGATTGC
                      ____________________________________________________________
consensus CTCGTCGTACGCGGCGATTGC
 
. : . : . : . : . : . :
JMFF013D07+ GACGCCGATTGAGATAGAGACCATGTTAGCCATGGTGGAGGGGTTATAGGCGTCTTTCTT
                      ____________________________________________________________
consensus GACGCCGATTGAGATAGAGACCATGTTAGCCATGGTGGAGGGGTTATAGGCGTCTTTCTT
 
. : . : . : . : . : . :
JMFF013D07+ GAAGAGGATTCCGATGGAGTAAACGGCGACGGGCATGAGGGCCTTGAGCATCTGGATGAA
JMFF006M22+ ATGAA
                      ____________________________________________________________
consensus GAAGAGGATTCCGATGGAGTAAACGGCGACGGGCATGAGGGCCTTGAGCATCTGGATGAA
 
. : . : . : . : . : . :
JMFF013D07+ GGAGACGGAGAGGTAGATGTAGGCGGAGTTGGAGAACCAGAGGGAGAGGGAGTAGAGGGC
JMFF006M22+ GGAGACGGAGAGGTAGATGTAGGCGGAGTTGGAGAACCAGAGGGAGAGGGAGTAGAGGGC
                      ____________________________________________________________
consensus GGAGACGGAGAGGTAGATGTAGGCGGAGTTGGAGAACCAGAGGGAGAGGGAGTAGAGGGC
 
. : . : . : . : . : . :
JMFF013D07+ GCCGATGGGGATGATGCACGTGAGGTACACGTGACGGGAGAGAGGCGTGGACGGCGGGTC
JMFF023K07+ ATGGGAATGATGCACGTGAGGTACACGTGACGGGAGAGAGGCGTGGACGGCGGGTC
JMFF006M22+ GCCGATGGGAATGATGCACGTGAGGTACACGTGACGGGAGAGAGGCGTGGACGGCGGGTC
                      ____________________________________________________________
consensus GCCGATGGGAATGATGCACGTGAGGTACACGTGACGGGAGAGAGGCGTGGACGGCGGGTC
 
. : . : . : . : . : . :
JMFF013D07+ CACCAGGCGGGCGACTCGGACGAGGAAGAAGGCGACGGAGGAGCAGAAGGCCATGTGGAT
JMFF023K07+ CACCAGGCGGGCGACTCGGACGAGGAAGAAGGCGACGGAGGAGCAGAAGGCCATGTGGAT
JMFF006M22+ CACCAGGCGGGCGACTCGGACGAGGAAGAAGGCGACGGAGGAGCAGAAGGCCATGTGGAT
                      ____________________________________________________________
consensus CACCAGGCGGGCGACTCGGACGAGGAAGAAGGCGACGGAGGAGCAGAAGGCCATGTGGAT
 
. : . : . : . : . : . :
JMFF013D07+ CATGGTGAGGGAGATTGGGAAGGGCCAGTTGTAGAGCTTCTTGTCCAGGATGTACTTGTT
JMFF023K07+ CATGGTGAGGGAGATTGGGAAGGGCCAGTTGTAGAGCTTCTTGTCCAGGATGTACTTGTT
JMFF006M22+ CATGGTGAGGGAGATTGGGAAGGGCCAGTTGTAGAGCTTCTTGTCCAGGATGTACTTGTT
                      ____________________________________________________________
consensus CATGGTGAGGGAGATTGGGAAGGGCCAGTTGTAGAGCTTCTTGTCCAGGATGTACTTGTT
 
. : . : . : . : . : . :
JMFF013D07+ GTAGACGATGACGGTGAAGGAGAGGAAGATCCACACCGCCACGTAGGCGTAGGAGAGGAT
JMFF023K07+ GTAGACGATGACGGTGAAGGAGAGGAAGATCCACACCGCCACGTAGGCGTAGGAGAGGAT
JMFF006M22+ GTAGACGATGACGGTGAAGGAGAGGAAGATCCACACCGCCACGTAGGCGTAGGAGAGGAT
                      ____________________________________________________________
consensus GTAGACGATGACGGTGAAGGAGAGGAAGATCCACACCGCCACGTAGGCGTAGGAGAGGAT
 
. : . : . : . : . : . :
JMFF013D07+ GATCTTCTTGATTACGCCGTCGGAGAGTGCGCCGCCTTTCCCCATTGTGCCGGTGGC
JMFF023K07+ GATCTTCTTGATTACGCCGTCGGAGAGTGCGCCGCCTTTCCCCATTGTGCCGGTGGCCGT
JMFF006M22+ GATCTTCTTGATTACGCCGTCGGAGAGTGCGCCGCCTTTCCCCATTGTGCCGGTGGCCGT
                      ____________________________________________________________
consensus GATCTTCTTGATTACGCCGTCGGAGAGTGCGCCGCCTTTCCCCATTGTGCCGGTGGCCGT
 
. : . : . : . : . : . :
JMFF023K07+ CCCGCTCCCTTTTGACCACGTTTCCACAATCAGCTGCGCGTTCCACCCCGCCGCCATGGC
JMFF006M22+ CCCGCTCCCTTTTGACCACGTTTCCACAATCAGCTGCGCGTTCCACCCCGCCGCCATGGC
                      ____________________________________________________________
consensus CCCGCTCCCTTTTGACCACGTTTCCACAATCAGCTGCGCGTTCCACCCCGCCGCCATGGC
 
. : . : . : . : . : . :
JMFF023K07+ CGATATCAGCTCCGCTACGCTAGATTCTTCAATCAACTCGCACTGCACCCCACCCCAATC
JMFF006M22+ CGATATCAGCTCCGCTACGCTAGATTCTTCAATCAACTCGCACTGCACCCCACCCCAATC
                      ____________________________________________________________
consensus CGATATCAGCTCCGCTACGCTAGATTCTTCAATCAACTCGCACTGCACCCCACCCCAATC
 
. : . : . : . : . : . :
JMFF023K07+ AACAGATTAAACCCCGAAAAACAAAGGGTAGTCCACAAAAAAATGAATCATTTTCACGAT
JMFF006M22+ AACAGATTAAACCCCGAAAAACAAAGGGTAGTCCACAAAAAAATGAATCATTTTCACGAT
                      ____________________________________________________________
consensus AACAGATTAAACCCCGAAAAACAAAGGGTAGTCCACAAAAAAATGAATCATTTTCACGAT
 
. : . : . : . : . : . :
JMFF023K07+ TTCTTACCGATTTCACAGTATCGATATAGGCCTTTGAGGCTTTCTCCGGCGACCAAAGCC
JMFF006M22+ TTCTTACCGATTTCACAGTATCGATATAGGCCTTTGAGGCTTTCTCCGGCGACCAAAGCC
                      ____________________________________________________________
consensus TTCTTACCGATTTCACAGTATCGATATAGGCCTTTGAGGCTTTCTCCGGCGACCAAAGCC