Previous Contig 000344:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003F01Sequence508000344 (42)gb:AX298155_14653365e-25Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-183000344 (42)
JMFF004E15Sequence472000344 (42)gb:AF061282_17651932e-18Sorghum bicolor 22 kDa kafirin cluster.746000344 (42)gb:AX298155_14653363e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF006F15Sequence531000344 (42)gb:AX298155_14653362e-26Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-769000344 (42)gb:AX298155_14653362e-35Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF006M11Sequence607000344 (42)gb:AX298155_14653362e-35Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-754000344 (42)gb:AX298155_14653363e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF011I11Sequence585000344 (42)gb:AX298155_14653366e-34Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-766000344 (42)gb:AX298155_14653363e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF013C10Sequence533000344 (42)gb:AX298155_14653362e-26Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-778000344 (42)gb:AX298155_14653361e-38Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF014L07Sequence585000344 (42)gb:AX298155_14653366e-34Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-630000344 (42)gb:AX298155_14653366e-31Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF015A21Sequence607000344 (42)gb:AX298155_14653362e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-659000344 (42)gb:AX298155_14653365e-31Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF015J01Sequence197000344 (42)568000344 (42)gb:AX298155_14653366e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF023B10Sequence488000344 (42)gb:AX298155_14653367e-20Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-752000344 (42)gb:AX298155_14653363e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF026N13Sequence519000344 (42)gb:AX298155_14653361e-25Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-673000344 (42)gb:AX298155_14653366e-37Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF030N18Sequence583000344 (42)gb:AX298155_14653369e-33Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-672000344 (42)gb:AX298155_14653362e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF032M06Sequence536000344 (42)gb:AX298155_14653362e-26Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-749000344 (42)gb:AX298155_14653362e-35Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF035M10Sequence523000344 (42)gb:AX298155_14653367e-25Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-699000344 (42)gb:AX298155_14653362e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF037D24Sequence533000344 (42)gb:AX298155_14653362e-26Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF039K22Sequence577000344 (42)gb:AX298155_14653362e-34Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-738000344 (42)gb:AX298155_14653363e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFF046E20Sequence573000344 (42)gb:AF061282_17651933e-18Sorghum bicolor 22 kDa kafirin cluster.527021755
JMFS011G12Sequence596000344 (42)gb:AP006849_18630892e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN
JMFS037C06Sequence609000344 (42)gb:AX298155_14653364e-38Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFS068A11Sequence642000344 (42)gb:AX298155_14653361e-39Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFS090C07Sequence613000344 (42)gb:AX298155_14653366e-57Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFS143B06Sequence613000344 (42)gb:AX298155_14653367e-39Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFS148E03Sequence610000344 (42)gb:AX298155_14653362e-36Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMFS149F01Sequence176000344 (42)
JMFS157G12Sequence424000344 (42)gb:AF061282_17651932e-18Sorghum bicolor 22 kDa kafirin cluster.
JMFS162C03Sequence521000344 (42)gb:AX298155_14653364e-10Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-
JMSF044E03Sequence713000180 (6)gb:AX298155_14653365e-64Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-752000344 (42)gb:AX298155_14653365e-40Sequence 1 from Patent WO0183788.>gb:AF158027_1773158 Nicotiana tabacum patatin-

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS162C03- TTCGGCACGAGGGA
                      ____________________________________________________________
consensus TTCGGCACGAGGGA
 
. : . : . : . : . : . :
JMFS149F01- ACATAATTT
JMFS162C03- GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTGGACCAAAAGTACGTGTACATAATTT
rJMFF011I11- TAATTT
rJMFF006F15- TAATTT
                      ____________________________________________________________
consensus GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTGGACCAAAAGTACGTGTACATAATTT
 
. : . : . : . : . : . :
JMFS149F01- AATCATTTATTACATTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
JMFS162C03- AATCATTTATTACATTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF035M10- ATTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF015A21- TTATTACATTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF014L07- TTTATTACATTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF011I11- AATCATTTATTACATTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF039K22- CATTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF006F15- AATCATTTATTACATTAATAATAGGTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF023B10- ATTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF030N18- TTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF006M11- TTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF032M06- TTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF004E15- TAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
rJMFF013C10- TTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
                      ____________________________________________________________
consensus AATCATTTATTACATTAATAATA-GTCCATACATAGCACGGGACACTTACTAGTTTATAC
 
. : . : . : . : . : . :
JMFS149F01- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
JMFS162C03- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF035M10- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF015A21- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF014L07- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF011I11- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF039K22- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF006F15- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF023B10- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF030N18- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
JMFS148E03+ AATGGCACAACCTTTTTCATGTCGAAG
rJMSF044E03- CATACTTATGTAAACAATCCCAGTCGCACAACCTTTTTTATGTGGCAG
rJMFF006M11- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF032M06- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF004E15- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
rJMFF026N13- GTCGAAG
rJMFF013C10- AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
                      ____________________________________________________________
consensus AAAATACACAAGCATACATATGTAACCAATCCCAATGGCACAACCTTTTTCATGTCGAAG
 
. : . : . : . : . : . :
JMFS149F01- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACAC
JMFS162C03- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF035M10- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF015A21- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF014L07- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF011I11- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF039K22- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF006F15- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF023B10- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF030N18- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
JMFS148E03+ GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMSF044E03- GGTATGTGCCTTATTCAACAATAATTCAAGTATCAGAAATAAAAGACACACG----ATAT
rJMFF006M11- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF032M06- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF004E15- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF026N13- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
rJMFF013C10- GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
                      ____________________________________________________________
consensus GATATGTGCCTTATTCA---ATAATTCAAGTAGCAGAAATTAAAGACACACGATACATAT
 
. : . : . : . : . : . :
JMFS162C03- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF035M10- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF015A21- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF014L07- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF011I11- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF039K22- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF006F15- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF023B10- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF030N18- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
JMFS148E03+ GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF015J01- GATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMSF044E03- GATCTCATTATTGATCAACAACGTAACTTGGCTACTAGTTGCCGTTAAGTGCCGCGATTG
rJMFF006M11- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF032M06- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF004E15- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF026N13- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
rJMFF013C10- GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
                      ____________________________________________________________
consensus GATCTCAATGTTGATCAACACCGTAACTTAACTACTTGCCGCCGTTAAGTGCCGCGATTG
 
. : . : . : . : . : . :
JMFS162C03- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF035M10- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF015A21- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF014L07- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF011I11- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF039K22- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF006F15- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF023B10- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF030N18- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF003F01- TACGGCGCCTCCTCTCCTNCGACAGCAAACCGGNCAACCTTTTNANANCATCTTTGNTTG
JMFS148E03+ TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF015J01- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCANAGCATCTTTGTTTG
rJMSF044E03- TGCGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTGGTTAG
rJMFF006M11- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF032M06- TACGGCGCCTCCCCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF004E15- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF026N13- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
rJMFF013C10- TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
                      ____________________________________________________________
consensus TACGGCGCCTCCTCTCCTCCGACAGCAAACCGGCCAACCTTTTCAGAGCATCTTTGTTTG
 
. : . : . : . : . : . :
JMFS162C03- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF035M10- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF015A21- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF014L07- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF011I11- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF039K22- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF006F15- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF023B10- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF030N18- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF003F01- TTCCNNCTTTGNGGACCGGNTCNTTCTTCNCTGTCAANANATTCNNCTTCAAAACCGGNT
JMFS148E03+ TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF015J01- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMSF044E03- TTCCAGCTTGGGGGACCGGTTCATTCTTCCCTGTCAATAGATTCAGCTTCATAACCGGTT
rJMFF006M11- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF032M06- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF004E15- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF026N13- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
rJMFF013C10- TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
                      ____________________________________________________________
consensus TTCCAGCTTTGGGGACCGGTTCATTCTTCCCTGTCAACAGATTCAGCTTCAAAACCGGTT
 
. : . : . : . : . : . :
JMFS162C03- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF035M10- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF015A21- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF014L07- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF011I11- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF039K22- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF006F15- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTCCTTTTGTCGTAACAT
rJMFF023B10- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF030N18- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF003F01- TCGTCAACNACTTCTTGCCNACCTCTTCANGNGCATCCNAATTTTCTTTTGTCG
JMFS148E03+ TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF015J01- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMSF044E03- TGGACAACAAGTTCTTGCCAACCTCTTCAAGTGCATCCAAGTTTTCTTTTGTCGTAACAT
rJMFF006M11- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF032M06- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF004E15- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF026N13- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
rJMFF013C10- TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
JMFS011G12+ GTAACAT
                      ____________________________________________________________
consensus TCGTCAACAACTTCTTGCCAACCTCTTCAAGTGCATCCAAATTTTCTTTTGTCGTAACAT
 
. : . : . : . : . : . :
JMFS162C03- CAACCGAGGCTGTCGACCCTTTTAAATCGTC
rJMFF035M10- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF015A21- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF014L07- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF011I11- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF039K22- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF006F15- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF023B10- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF030N18- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
JMFS148E03+ CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF015J01- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMSF044E03- CAACCGAGGCGGTCGACCCTTTTAAATCATCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF006M11- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF032M06- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF004E15- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF026N13- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
rJMFF013C10- CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
JMFS011G12+ CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
                      ____________________________________________________________
consensus CAACCGAGGCTGTCGACCCTTTTAAATCGTCCTCCTGGATGCGGAGATAGTTATCTCCGG
 
. : . : . : . : . : . :
rJMFF035M10- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF015A21- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF014L07- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF011I11- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF039K22- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF006F15- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF023B10- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF030N18- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
JMFS148E03+ CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF015J01- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMSF044E03- CTTTAAGAGAACGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCACCGG
rJMFF006M11- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF032M06- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF004E15- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF026N13- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
rJMFF013C10- CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
JMFS011G12+ CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
                      ____________________________________________________________
consensus CTTGAAGAGCCTGGAAAATGGTGGCGATATGATAATCCACCATGTCCGCACTTGCAACGG
 
. : . : . : . : . : . :
rJMFF035M10- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF015A21- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF014L07- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGACAGCCACCCCAAAACACCCCATG
rJMFF011I11- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF039K22- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF006F15- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF023B10- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF030N18- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
JMFS148E03+ AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF015J01- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMSF044E03- AGAATACATCAATCAAAGGGTTGCCGTCTCGTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF006M11- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF032M06- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF004E15- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF026N13- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
rJMFF013C10- AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
JMFS011G12+ AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
                      ____________________________________________________________
consensus AGAATACATCAATCAAAGGGTTGCCGTCTCCTTGGGCCAGCCACCCCAAAACACCCCATG
 
. : . : . : . : . : . :
rJMFF035M10- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF015A21- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTGAAATTGCCGGTGCCGATCGAC
rJMFF014L07- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG
rJMFF011I11- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF039K22- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF006F15- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF023B10- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF030N18- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
JMFS148E03+ TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF015J01- TCGCCGCCTGTTGCGCCGTGTACTTATCANCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMSF044E03- TCGCCGCCTGTTGCGCCGTGTACTTATCGGCTTTTTTTG-CATTGCCGGTGCCGATCGAC
rJMFF006M11- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF032M06- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF004E15- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF026N13- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
rJMFF013C10- TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
JMFS011G12+ TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
                      ____________________________________________________________
consensus TCGCCGCCTGTTGCGCCGTGTACTTATCAGCATATTTTG-AATTGCCGGTGCCGATCGAC
 
. : . : . : . : . : . :
rJMFF035M10- AATATCAAGAACCGGTGGCACCCAACTGCCT-CCTTCGACGAAGTTGATGATGTCAAG
rJMFF015A21- AATATCAAG
rJMFF011I11- AATATCAAGAACCGGTGGCACCCAACTGCCT-CCTTCGACGAAGTTGATGATGTCAAGTA
rJMFF039K22- AATATCAAGAACCGGTGGCACCCAACTGCCTCCCTTCGACGAAGTTGATGATGTCAAGTA
rJMFF006F15- AATATCAAGAACCGGTGGCACCCAACTGCCTCCCTTCGACGAAGTTGATGATGTCAAGTA
rJMFF023B10- AATATCAAGAACCGGTGGCACCCAACTGCCTCCCTTCGACGAAGTTGATGATGTCAAGTA
rJMFF030N18- AATATCAAGAACCGGTGGCACCCAACTGCCT
JMFS148E03+ AATATCAAGAACCGGTGGCACCCAACTGCCT-CCTTCGACGAAGTTGA
rJMFF015J01- AATATCAAGAACCGGTGGCACCCAACTGCCT-CCTTCGACGAAGTTGATGATGTCAAGTA
rJMSF044E03- AATATCAATAAATGGTGGCACCCAGTTGGAT-CATTCGACGAA
rJMFF006M11- AATATCAAGAACCGGTGGCACCCAACTGCCT-CCTTCGACGAAGTTGATGATGTCAAGTA
rJMFF032M06- AATATCAAGAACCGGTGGCACCCAACTGCCTCCCTTCGACGAAGTTGATGATGTCAAGTA
rJMFF004E15- AATATCAAGAACCGGTGGCACCCAACTGCCTCCCTTCGACGAAGTTGATGATGTCNAGTA
rJMFF026N13- AATATCAAGAACCGGTGGCACCCAACTGCCT-CCTTCGACGAAGTTGATGATGTCAAGTA
rJMFF013C10- AATATCAAGAACCGGTGGCACCCAACTGCCTCCCTTCGACGAAGTTGATGATGTCAAGTA
JMFS011G12+ AATATCAAGAACCGGTGGCACCCAACTGCCT-CCTTCGACGAAGTTGATGATGTCAAGTA
                      ____________________________________________________________
consensus AATATCAAGAACCGGTGGCACCCAACTGCCT-CCTTCGACGAAGTTGATGATGTCAAGTA
 
. : . : . : . : . : . :
rJMFF011I11- TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCGTGCTAATCGCA
rJMFF039K22- TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCG
rJMFF006F15- TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCGTGCTAATCGCAA
rJMFF023B10- TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCGTGCTAATCGCAATAA
rJMFF015J01- TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCAC
rJMFF006M11- TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCGTGCTAATCGCAATAA
rJMFF032M06- TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCGTGCTAATCGCAAT
rJMFF004E15- TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCGTGCTAATCGCA
rJMFF026N13- TTTTGGATCCTTAGCCACCATCCCTTTGCGTCACCGTGCTAATCGCAATAAGAGTCGGAT
rJMFF013C10- TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCGTGCTAATCGCAATAAGAGTCGGAT
JMFS011G12+ TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCGTGCTAATCGCAATAAGAGTCGGAT
                      ____________________________________________________________
consensus TTTTGGATCCTTAGCCACCAT-CCTTTGCGTCACCGTGCTAATCGCAATAAGAGTCGGAT
 
. : . : . : . : . : . :
rJMFF026N13- TGTTTGC
rJMFF013C10- TGTTTGCAGCTACACC
JMFS011G12+ TGTTTGCAGCTACACCTCCGTCAATGAGGTTGTACTCGACCTTTCCGCCCTTAGCATCGG
JMFS090C07+ TTGCAGCTACACCTCCGTCAATGAGGTTGTACTCGACCTTTCCGCCCTTAGCATCGG
                      ____________________________________________________________
consensus TGTTTGCAGCTACACCTCCGTCAATGAGGTTGTACTCGACCTTTCCGCCCTTAGCATCGG
 
. : . : . : . : . : . :
JMFS011G12+ CGGTGTCAAAGTAATGGCCGGGGAGGTACGTGGGAGCTGCGGAGGTGGCAATGCATATGT
JMFS090C07+ CGGTGTCAAAGTAATGGCCGGGGAGGTACGTGGGAGCTGCGGAGGTGGCAATGCATATGT
                      ____________________________________________________________
consensus CGGTGTCAAAGTAATGGCCGGGGAGGTACGTGGGAGCTGCGGAGGTGGCAATGCATATGT
 
. : . : . : . : . : . :
JMFS011G12+ CTGACAACTTAGCATTCTTTTCGGGGGAATCCTTAACATCGCAAGTGGTGAAAACTGTGG
JMFS090C07+ CTGACAACTTAGCATTCTTTTCGGGGGAATCCTTAACATCGCAAGTGGTGAAAACTGTGG
JMFS143B06+ AGCATTCTTTTCGGGGGAATCCTTAACATCGCAAGTGGTGAAAACTGTGG
JMFS037C06+ TAACATCGCAAGTGGTGAAAACTGTGG
JMFS068A11+ GACAACTTAGCATTCTTTTCGGGGGAATCCTTAACATCGCAAGTGGTGAAAACTGTGG
JMFF015A21+ ACTGTGG
JMFF006M11+ ACTGTGG
                      ____________________________________________________________
consensus CTGACAACTTAGCATTCTTTTCGGGGGAATCCTTAACATCGCAAGTGGTGAAAACTGTGG
 
. : . : . : . : . : . :
JMFS011G12+ GTTGGAAGGTCTTGATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTG
JMFS090C07+ GTTGGAAGGTCTTGATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
JMFS143B06+ GTTGGAAGGTCTTGATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
JMFS037C06+ GTTGGAAGGTCTTGATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
JMFF039K22+ TCTTGATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
JMFS068A11+ GTTGGAAGGTCTTGATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
JMFF015A21+ GTTGGAAGGTCTTGATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
JMFF014L07+ GATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
JMFF011I11+ GATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
JMFF030N18+ TCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
JMFF006M11+ GTTGGAAGGTCTTGATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
                      ____________________________________________________________
consensus GTTGGAAGGTCTTGATATCAAAGGCAGGGATGACAATGTGCGTCAAAGTTTGGCTCAACC
 
. : . : . : . : . : . :
JMFS090C07+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFS143B06+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFS037C06+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF039K22+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFS068A11+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF015A21+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGNC
JMFF014L07+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF011I11+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF032M06+ TTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF030N18+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF035M10+ TCCTGGAGGACTTGGTGAAGGTATTTGTCGTCGTACTTGGGAC
JMFF023B10+ CTTGGGAC
JMFF013C10+ TCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF037D24+ TCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF026N13+ CTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF003F01+ TTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF006F15+ TCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
JMFF006M11+ GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
                      ____________________________________________________________
consensus GAGTTTCTCCCAATTGGTCCTGGAGGACTTGGTGAAGGTATTTGCCGTCGTACTTGGGAC
 
. : . : . : . : . : . :
JMFS090C07+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFS143B06+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFS037C06+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF039K22+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFS068A11+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF015A21+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF014L07+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF011I11+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF032M06+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF030N18+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF035M10+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF023B10+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF013C10+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF037D24+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF026N13+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFS157G12+ ATTCCTGCTGATGGGAAGATCT
JMFF003F01+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF006F15+ CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF046E20+ GCTGATGGGAAGATCT
JMFF004E15+ ACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
JMFF006M11+ GGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
                      ____________________________________________________________
consensus CGGCCAACAGGCTGGTTGCGTCTCTCACCACCTCAAATATTCCTGCTGATGGGAAGATCT
 
. : . : . : . : . : . :
JMFS090C07+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFS143B06+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFS037C06+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF039K22+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFS068A11+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF015A21+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF014L07+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF011I11+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF032M06+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF030N18+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF035M10+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF023B10+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF013C10+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF037D24+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF026N13+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFS157G12+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF003F01+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF006F15+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF046E20+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF004E15+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
JMFF006M11+ TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
                      ____________________________________________________________
consensus TTGGTCCGTGCTCCTTGTAGAAAGGGACAATATCCTTGCCGGCGTAGAGGGGGCGCTTGT
 
. : . : . : . : . : . :
JMFS090C07+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFS143B06+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFS037C06+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF039K22+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFS068A11+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF015A21+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF014L07+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGACCTCCGGTGCTCGTTCCGGCAATCA
JMFF011I11+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF032M06+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF030N18+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF035M10+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF023B10+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF013C10+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF037D24+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF026N13+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFS157G12+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF003F01+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF006F15+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF046E20+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF004E15+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
JMFF006M11+ TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
                      ____________________________________________________________
consensus TCTTGTCCGGCGCCGATAACATGGTGGTCATCAGCCCTCCGGTGCTCGTTCCGGCAATCA
 
. : . : . : . : . : . :
JMFS090C07+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFS143B06+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFS037C06+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF039K22+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFS068A11+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF015A21+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF014L07+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF011I11+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF032M06+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF030N18+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF035M10+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF023B10+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF013C10+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF037D24+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF026N13+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFS157G12+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF003F01+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF006F15+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF046E20+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF004E15+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
JMFF006M11+ CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
                      ____________________________________________________________
consensus CATCGAAGTAGTCCGCTGCTCTTGCATCCGGACCGTCCAAAGCTTGAAGCTCCTCTTCAA
 
. : . : . : . : . : . :
JMFS090C07+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFS143B06+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFS037C06+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF039K22+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFS068A11+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF015A21+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF014L07+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF011I11+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF032M06+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF030N18+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF035M10+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF023B10+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF013C10+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF037D24+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF026N13+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFS157G12+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF015J01+ CCTCCGTCAATGCTAAGGA
JMFF003F01+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF006F15+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF046E20+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF004E15+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
JMFF006M11+ GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
                      ____________________________________________________________
consensus GGTAAGCGACAATGGTGCCGGGGATGATGCCACGGATGCCACCTCCGTCAATGCTAAGGA
 
. : . : . : . : . : . :
JMFS090C07+ TGGTGATAACGCCGCC
JMFS143B06+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFS037C06+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF039K22+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFS068A11+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF015A21+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF014L07+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF011I11+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF032M06+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF030N18+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF035M10+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF023B10+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF013C10+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF037D24+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF026N13+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFS157G12+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF015J01+ TGGTGATAACGCCNCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF003F01+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF006F15+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF046E20+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF004E15+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
JMFF006M11+ TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
                      ____________________________________________________________
consensus TGGTGATAACGCCGCCGGGAGGGATGGACGCAGCATTGTACTCTCCGGTGGCGGGATTGG
 
. : . : . : . : . : . :
JMFS143B06+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFS037C06+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF039K22+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFS068A11+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF015A21+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF014L07+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF011I11+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF032M06+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF030N18+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF035M10+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF023B10+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF013C10+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF037D24+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF026N13+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFS157G12+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF015J01+ CGGCGGAGGATGGGGCTGACGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF003F01+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF006F15+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF046E20+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF004E15+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
JMFF006M11+ CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
                      ____________________________________________________________
consensus CGGCGGAGGATGGGGCTGATGGGGTTGTCTGGGTGTTTCCCATTTCAAAGGATTGGTATG
 
. : . : . : . : . : . :
JMFS143B06+ ATATAGAAAAAAAATGTTATCAA
JMFS037C06+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTT
JMFF039K22+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTT
JMFS068A11+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTG
JMFF015A21+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAATGT
JMFF014L07+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAAT
JMFF011I11+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAAT
JMFF032M06+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAATG
JMFF030N18+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAATGT
JMFF035M10+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAATGT
JMFF023B10+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAATGT
JMFF013C10+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAATGT
JMFF037D24+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAAT
JMFF026N13+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAAT
JMFS157G12+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTT
JMFF015J01+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTT
JMFF003F01+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTT
JMFF006F15+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAAT
JMFF046E20+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAA
JMFF004E15+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAAT
JMFF006M11+ ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAATGT
                      ____________________________________________________________
consensus ATATAGAAAAAAAATGTTATCAAGAGAAATGATAAAGATTTTTGTTGGTTTCTTTAATGT