Previous Contig 000341:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003O01Sequence522000341 (6)gb:AP003416_18291810.009Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045785010554 (5)gb:AB008265_15103952e-49Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12.
JMFF006L18Sequence561000341 (6)gb:AP003416_18291810.011Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045781010554 (5)gb:AB008265_15103951e-55Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12.
JMFF045I24Sequence618000341 (6)gb:AY060589_15648921e-13Arabidopsis thaliana AT5g63120/MDC12_8 mRNA, complete cds.>gb:BT000610_1634888 A653010554 (5)gb:AB008265_15103957e-17Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12.
JMFS117C12Sequence481000341 (6)gb:AP003416_18291810.007Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMSF015M06Sequence485000341 (6)gb:AP003416_18291810.029Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045798010554 (5)gb:AB008265_15103957e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12.
JMSF019C11Sequence544000341 (6)gb:AY060589_15648922e-22Arabidopsis thaliana AT5g63120/MDC12_8 mRNA, complete cds.>gb:BT000610_1634888 A792010554 (5)gb:AB008265_15103952e-15Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019C11+ AATACGCAGGAAAGTTTGCCTC
                      ____________________________________________________________
consensus AATACGCAGGAAAGTTTGCCTC
 
. : . : . : . : . : . :
JMSF019C11+ ATGGAACATTCGAATTGGCTTTGGGATATCCGTGCCCTCAACTGTAACCTCACGCCTTGC
                      ____________________________________________________________
consensus ATGGAACATTCGAATTGGCTTTGGGATATCCGTGCCCTCAACTGTAACCTCACGCCTTGC
 
. : . : . : . : . : . :
JMSF019C11+ ACGATATAGTGCAACCTCGTGCTCAGTCATTGCCATCACTGATGGACTCTCAGAGTAGAA
JMFF045I24+ CGATATAGTGCAACCTCGTGCTCAGTCATTGCCATCACTGATGGACTCTCAGAGTAGAA
                      ____________________________________________________________
consensus ACGATATAGTGCAACCTCGTGCTCAGTCATTGCCATCACTGATGGACTCTCAGAGTAGAA
 
. : . : . : . : . : . :
JMSF019C11+ GTTCTTCTCAAAGCGAACCAAGTTTCCAAAATCTTGTTTTGGAAGGGAAATGTTATCCAA
JMFF045I24+ GTTCTTCTCAAAGCGAACCAAGTTTCCAAAATCTTGTTTTGGAAGGGAAATGTTATCCAA
JMFF003O01+ TGGAAGGGAAATGTTATCCAA
JMFF006L18+ TGGAAGGGAAATGTTATCCAA
                      ____________________________________________________________
consensus GTTCTTCTCAAAGCGAACCAAGTTTCCAAAATCTTGTTTTGGAAGGGAAATGTTATCCAA
 
. : . : . : . : . : . :
JMSF019C11+ ATCATCTCGCCCCCTGCCATGTGCCCCATGCCTACCTGTGCCACCACTTCGCCCTCCATC
JMFF045I24+ ATCATCTCGCCCCCTGCCATGTGCCCCATGCCTACCTGTGCCACCACTTCGCCCTCCATC
JMSF015M06+ GCCATGTGCCCCATGCCTACCTGTGCCACCACTTCGCCCTCCATC
JMFF003O01+ ATCATCTCGCCCCCTGCCATGTGCCCCATGCCTACCTGTGCCACCACTTCGCCCTCCATC
JMFS117C12+ CACCACTTCGCCCTCCATC
JMFF006L18+ ATCATCTCGCCCCCTGCCATGTGCCCCATGCCTACCTGTGCCACCACTTCGCCCTCCATC
                      ____________________________________________________________
consensus ATCATCTCGCCCCCTGCCATGTGCCCCATGCCTACCTGTGCCACCACTTCGCCCTCCATC
 
. : . : . : . : . : . :
JMSF019C11+ ATATCCAGATCTCCCACCTCCACGTCCACCGTGTCCTCTATCAAACCCCCT-CCCACTAG
JMFF045I24+ ATATCCAGATCTCCCACCTCCACGTCCACCGTGTCCTCTATCAAACCCCCT-CCCACTAG
JMSF015M06+ ATATCCAGATCTCCCACCTCCACGTCCACCGTGTCCTCTATCAAACCCCCT-CCCACTAG
JMFF003O01+ ATATCCAGATCTCCCACCTCCACGTCCACCGTGTCCTCTATCAAACCCCCT-CCCACTAG
JMFS117C12+ ATATCCAGATCTCCCACCTCCACGTCCACCGTGTCCTCTATCAAACCCCCT-CCCACTAG
JMFF006L18+ ATATCCAGATCTCCCACCTCCACGTCCACCGTGTCCTCTATCAAACCCCCTCCCCACTAG
                      ____________________________________________________________
consensus ATATCCAGATCTCCCACCTCCACGTCCACCGTGTCCTCTATCAAACCCCCT-CCCACTAG
 
. : . : . : . : . : . :
JMSF019C11+ CCCTACCCCCTCGGCTCAAATCAAATCCCCGCCCAGCACCACCTCGATCCTCATTCCCAC
JMFF045I24+ CCCTACCCCCTCGGCTCAAATCAAATCCCCGCCCAGCACCACCTCGATCCTCATTCCCAC
JMSF015M06+ CCCTACCCCCTCGGCTCAAATCAAATCCCCGCCCAGCACCACCTCGATCCTCATTCCCAC
JMFF003O01+ CCCTACCCCCTCGGCTCAAATCAAATCCCCGCCCAGCACCACCTCGATCCTCATTCCCAC
JMFS117C12+ CCCTACCCCCTCGGCTCAAATCAAATCCCCGCCCAGCACCACCTCGATCCTCATTCCCAC
JMFF006L18+ CCCTACCCCCTCGGCTCAAATCAAATCCCCGCCCAGCACCACCTCGATCCTCATCCCCAC
                      ____________________________________________________________
consensus CCCTACCCCCTCGGCTCAAATCAAATCCCCGCCCAGCACCACCTCGATCCTCATTCCCAC
 
. : . : . : . : . : . :
JMSF019C11+ CAGTCTGGAAAGAAGGGAACCCTGAATAACGTGGCGGAGCCACCACAGGACCTCCATAAG
JMFF045I24+ CAGTCTGGAAAGAAGGGAACCCTGAATAACGTGGCGGAGCCACCACAGGACCTCCATAAG
JMSF015M06+ CAGTCTGGAAAGAAGGGAACCCTGAATAACGTGGCGGAGCCACCACAGGACCTCCATAAG
JMFF003O01+ CAGTCTGGAAAGAAGGGAACCCTGAATAACGTGGCGGAGCCACCACAGGACCTCCATAAG
JMFS117C12+ CAGTCTGGAAAGAAGGGAACCCTGAATAACGTGGCGGAGCCACCACAGGACCTCCATAAG
JMFF006L18+ CAGTCTGGAAAGAAGGGAACCCTGAATAACGTGGCGGAGCCACCACAGGACCTCCATAAG
                      ____________________________________________________________
consensus CAGTCTGGAAAGAAGGGAACCCTGAATAACGTGGCGGAGCCACCACAGGACCTCCATAAG
 
. : . : . : . : . : . :
JMSF019C11+ GAGTTGGGGCACCACGGCTATTACTTAAGGCAGCTCCACCGGCTATATGCGGTGGCCCTA
JMFF045I24+ GAGTTGGGGCACCACGGCTATTACTTAAGGCAGCTCCACCGGCTATATGCGGTGGCCCTA
JMSF015M06+ GAGTTGGGGCACCACGGCTATTACTTAAGGCAGCTCCACCGGCTATATGCGGTGGCCCTA
JMFF003O01+ GAGTTGGGGCACCACGGCTATTACTTAAGGCAGCTCCACCGGCTATATGCGGTGGCCCTA
JMFS117C12+ GAGTTGGGGCACCACGGCTATTACTTAAGGCAGCTCCACCGGCTATATGCGGTGGCCCTA
JMFF006L18+ GAGTTGGGGCACCACGGCTATTACTTAAGGCAGCTCCACCGGCTATATGCGGTGGCCCTA
                      ____________________________________________________________
consensus GAGTTGGGGCACCACGGCTATTACTTAAGGCAGCTCCACCGGCTATATGCGGTGGCCCTA
 
. : . : . : . : . : . :
JMSF019C11+ TCAGATCACTTCTGCGTTGACGATAGGAATTGGAGTCAGCGT
JMFF045I24+ TCAGATCACTTCTGCGTTGACGATAGGAATTGGAGTCAGCGTATCTGGAATCGTAATTAG
JMSF015M06+ TCAGATCACTTCTGCGTTGACGATAGGGATTGGAGTCAGCGTATCTGGAATCGTAATTAG
JMFF003O01+ TCAGATCACTTCTGCGTTGACGATAGGAATTGGAGTCAGCGTATCTGGAATCGTAATTAG
JMFS117C12+ TCAGATCACTTCTGCGTTGACGATAGGAATTGGAGTCAGCGTATCTGGAATCGTAATTAG
JMFF006L18+ TCAGATCACTTCTGCGTTGACGATAGGAATTGGAGTCAGCGTATCTGGAATCGTAATTAG
                      ____________________________________________________________
consensus TCAGATCACTTCTGCGTTGACGATAGGAATTGGAGTCAGCGTATCTGGAATCGTAATTAG
 
. : . : . : . : . : . :
JMFF045I24+ GGTTGTACATTGTAGTGGCAACCTAGCAGGGTAGATGGATTGGAGTTAGGGTTTCCAAAT
JMSF015M06+ GGTTGTACATTGTAGTGGCAACCTAGCAGGGTAGATGGATTGGAGTTAGGGTTTCCAAAT
JMFF003O01+ GGTTGTACATTGTAGTGGCAACCTAGCAGGGTAGATGGATTGGAGTTAGGGTTTCCAAAT
JMFS117C12+ GGTTGTACATTGTAGTGGCAACCTAGCAGGGTAGATGGATTGGAGTTAGGGTTTCCAAAT
JMFF006L18+ GGTTGTACATTGTAGTGGCAACCTAGCAGGGTAGATGGATTGGAGTTAGGGTTTCCAAAT
                      ____________________________________________________________
consensus GGTTGTACATTGTAGTGGCAACCTAGCAGGGTAGATGGATTGGAGTTAGGGTTTCCAAAT
 
. : . : . : . : . : . :
JMFF045I24+ TGTAGACACGAGAACGATTTTCCCTCCTTAGAGTCTCCTCGGCTTGCTCTATTGAACTCG
JMSF015M06+ TGTAGACACGAGAACGATTTTCCCTCCTTAGAGTCTCCTCGGCTTGCTCTATTGAACTCG
JMFF003O01+ TGTAGACACGAGAACGATTTTCCCTCCTTAGAGTCTCCTCGGCTTGCTCTATTGAACTCG
JMFS117C12+ TGTAGACACGAGAACGATTTTCCCTCCTTAGAGTCTCCTCGGCTTGCTCTATTGAACTCG
JMFF006L18+ TGTAGACACGAGAACGATTTTCCCTCCTTAGAGTCTCCTCGGCTTGCTCTATTGAACTCG
                      ____________________________________________________________
consensus TGTAGACACGAGAACGATTTTCCCTCCTTAGAGTCTCCTCGGCTTGCTCTATTGAACTCG
 
. : . : . : . : . : . :
JMFF045I24+ TCAATGTAGATTGTCACGAT
JMSF015M06+ TCAATGTAGATTGTCACGA
JMFF003O01+ TCAATGTAGATTGTCACGAT
JMFS117C12+ TCAATGTAGATTGTCACGATTTTTAGATTACGTATTCGTTTCT
JMFF006L18+ TCAATGTAGATTGTCACGATTTTTAGATTACGTATTCGTTTCTTTCTATTTATAGAAAAT
                      ____________________________________________________________
consensus TCAATGTAGATTGTCACGATTTTTAGATTACGTATTCGTTTCTTTCTATTTATAGAAAAT