Previous Contig 000329:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006I18Sequence193000329 (3)705009296 (3)pir|T08594|T085942e-66probable sulfate adenylyltransferase (EC 2.7.7.4) - rape>gb:BNU68218_1633708 Bra
JMFF023E09Sequence470000329 (3)pir|S67498|S442672e-46sulfate adenylyltransferase (EC 2.7.7.4) met3-2 - potato>gb:STMET32_1722823 S. t727009296 (3)pir|S67498|S442672e-56sulfate adenylyltransferase (EC 2.7.7.4) met3-2 - potato>gb:STMET32_1722823 S. t
JMFN039F24Sequence654000329 (3)pir|S67498|S442673e-76sulfate adenylyltransferase (EC 2.7.7.4) met3-2 - potato>gb:STMET32_1722823 S. t

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN039F24+ CGAGCCAGTTCCCAGCA
                      ____________________________________________________________
consensus CGAGCCAGTTCCCAGCA
 
. : . : . : . : . : . :
JMFN039F24+ TTAGTTAGAGCCTCCTCGACGTATGGTAGCCCGGGGGCAGTGGTGCCCCAAGTCCTCGCT
                      ____________________________________________________________
consensus TTAGTTAGAGCCTCCTCGACGTATGGTAGCCCGGGGGCAGTGGTGCCCCAAGTCCTCGCT
 
. : . : . : . : . : . :
JMFN039F24+ ATTCGTTCTTCTTTGTTATGCTTGTATATTTCAATGTCTTTCAGAATGGCAACGGCCCGG
                      ____________________________________________________________
consensus ATTCGTTCTTCTTTGTTATGCTTGTATATTTCAATGTCTTTCAGAATGGCAACGGCCCGG
 
. : . : . : . : . : . :
JMFN039F24+ TGATTATCGTCGACGAGGGCAACGGAGCTGGACTCGCCAATCCGGCTCTTCTGGGAGTCG
JMFF023E09+ TGGGAGTCG
                      ____________________________________________________________
consensus TGATTATCGTCGACGAGGGCAACGGAGCTGGACTCGCCAATCCGGCTCTTCTGGGAGTCG
 
. : . : . : . : . : . :
JMFN039F24+ TCGACGGCGAGCACGATAGGCACCGACATGTTGACGACGGAGCCGTCTCCGAGCCGGAGC
JMFF023E09+ TCGACGGCGAGCACGATAGGCACCGACATGTTGACGACGGAGCCGTCTCCGAGCCGGAGC
                      ____________________________________________________________
consensus TCGACGGCGAGCACGATAGGCACCGACATGTTGACGACGGAGCCGTCTCCGAGCCGGAGC
 
. : . : . : . : . : . :
JMFN039F24+ GAGTTAAAATGAAGTGTTTGAAGGAACTCGGATTCCCTTTGGAACCCTTTCAAGGGGCTA
JMFF023E09+ GAGTTAAAATGAAGTGTTTGAAGGAACTCGGATTCCCTTTGGAACCCTTTCAAGGGGCTA
                      ____________________________________________________________
consensus GAGTTAAAATGAAGTGTTTGAAGGAACTCGGATTCCCTTTGGAACCCTTTCAAGGGGCTA
 
. : . : . : . : . : . :
JMFN039F24+ GCCCAGCCCTCGCTGAGCACATGAACCCATTGAAGATCGATCTTCGATAGCTTGATTTGG
JMFF023E09+ GCCCAGCCCTCGCTGAGCACATGAACCCATTGAAGATCGATCTTCGATAGCTTGATTTGG
                      ____________________________________________________________
consensus GCCCAGCCCTCGCTGAGCACATGAACCCATTGAAGATCGATCTTCGATAGCTTGATTTGG
 
. : . : . : . : . : . :
JMFN039F24+ GGCAGGCCCGACGCCAGTTTTCTCGCCGCCTCTCTCTCACCCTCCTTCACGAAGAGCTCC
JMFF023E09+ GGCAGGCCCGACGCCAGTTTTCTCGCCGCCTCTCTCTCACCCTCCTTCACGAAGAGCTCC
                      ____________________________________________________________
consensus GGCAGGCCCGACGCCAGTTTTCTCGCCGCCTCTCTCTCACCCTCCTTCACGAAGAGCTCC
 
. : . : . : . : . : . :
JMFN039F24+ ACCAGGCTGCCGCCGTCGGGCTCGATCAGCCCGCACGAAATCCGGACCCTGGCCCGGGCT
JMFF023E09+ ACCAGGCTGCCGCCGTCGGGCTCGATCAGCCCGCACGAAATCCGGACCCTGGCCCGGGCT
JMFF006I18+ CCTGGCCCGGGCT
                      ____________________________________________________________
consensus ACCAGGCTGCCGCCGTCGGGCTCGATCAGCCCGCACGAAATCCGGACCCTGGCCCGGGCT
 
. : . : . : . : . : . :
JMFN039F24+ CTGCCGGCGACCCGGGAAGGGACAGGGAAAGATAGCGGCTTGATCAATCGGGTTTCGTGG
JMFF023E09+ CTGCCGGCGACCCGGGAAGGGACAGGGAAAGATAGCGGCTTGATCAATCGGGTTTCGTGG
JMFF006I18+ NTGCCGGCGNCCCGGGAAGGGACAGGGAAAGATAGCGGCTTGATCAATCGGGTTTNGTGG
                      ____________________________________________________________
consensus CTGCCGGCGACCCGGGAAGGGACAGGGAAAGATAGCGGCTTGATCAATCGGGTTTCGTGG
 
. : . : . : . : . : . :
JMFN039F24+ GGTTTCGGGAAAGATTGCCGGGGAGTTGGAGTTTTGACGAATTGTAAAGCCGTGGACGCC
JMFF023E09+ GGTTTCGGGAAAGATTGCCGGGGAGTTGGAGTTTTGACGAATTGTAAAGCCGTGGACGCC
JMFF006I18+ GGTTTCGGGAAAGATTGCCGGGGAGTTGGAGTTTNGACGAATNGTAAANCCGTGGACGCC
                      ____________________________________________________________
consensus GGTTTCGGGAAAGATTGCCGGGGAGTTGGAGTTTTGACGAATTGTAAAGCCGTGGACGCC
 
. : . : . : . : . : . :
JMFN039F24+ ATGGCAGGCAGGGGAGTTTCTCTCTCTAGCAGAGAAG
JMFF023E09+ ATGGCAGGCAGGGGAGTTTCTCTCTCTAGCAGAGAAG
JMFF006I18+ ATGGCAGGCAGGGGAGTTTCTCTCTNTAGCAGAGAAGCAGAGAGAGAGAGAGAGAGAAAT
                      ____________________________________________________________
consensus ATGGCAGGCAGGGGAGTTTCTCTCTCTAGCAGAGAAGCAGAGAGAGAGAGAGAGAGAAAT