Previous Contig 000321:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006G22Sequence505000321 (28)gb:AC135928_17429184e-53Oryza sativa (japonica cultivar-group) chromosome 5 clone P0686B10, complete seq799000321 (28)gb:AY649841_16201243e-14Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,
JMFF013G01Sequence557000321 (28)gb:AY649841_16201243e-64Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,705000321 (28)
JMFF013N10Sequence487000321 (28)gb:AC135928_17429184e-53Oryza sativa (japonica cultivar-group) chromosome 5 clone P0686B10, complete seq789000321 (28)gb:AY649841_16201241e-12Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,
JMFF019E19Sequence595000321 (28)gb:AY649841_16201248e-71Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,752000321 (28)gb:AY649841_16201242e-06Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,
JMFF039A01Sequence607000321 (28)gb:AY649841_16201242e-70Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,740000321 (28)gb:AY649841_16201245e-08Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,
JMFF039D07Sequence477000321 (28)gb:AC135928_17429189e-54Oryza sativa (japonica cultivar-group) chromosome 5 clone P0686B10, complete seq545000321 (28)
JMFF039G06Sequence134000321 (28)gb:AK118074_18160743e-09Arabidopsis thaliana At4g02430 mRNA for unknown protein, complete cds, clone: RA655000321 (28)
JMFS034E03Sequence594000321 (28)gb:AY649841_16201242e-73Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,
JMFS162H07Sequence617000321 (28)gb:AY649841_16201243e-55Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,
JMSF004N13Sequence372001105 (3)gb:AY093136_15750909e-47Arabidopsis thaliana 26S proteasome subunit-like protein (At5g45620) mRNA, compl319000321 (28)
JMSF004P15Sequence232000321 (28)gb:AK118074_18160741e-24Arabidopsis thaliana At4g02430 mRNA for unknown protein, complete cds, clone: RA311022126pir|T07964|T079641e-06(S)-N-methylcoclaurine 3'-hydroxylase (EC 1.1.3.-) - California poppy>gb:AF01480
JMSF006E13Sequence277000321 (28)gb:AY649841_16201249e-29Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,469000321 (28)
JMSF012H12Sequence494000321 (28)gb:AC135928_17429182e-54Oryza sativa (japonica cultivar-group) chromosome 5 clone P0686B10, complete seq757000321 (28)gb:AY649841_16201243e-13Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,
JMSF021N10Sequence692000321 (28)gb:AY649841_16201241e-34Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,796023001
JMSF027I01Sequence634000321 (28)gb:AY649841_16201248e-75Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,689023277
JMSF037P07Sequence161000321 (28)gb:AK118074_18160742e-18Arabidopsis thaliana At4g02430 mRNA for unknown protein, complete cds, clone: RA177000321 (28)
JMSF048B23Sequence674000321 (28)gb:AY649841_16201242e-73Zea mays ASF/SF2-like pre-mRNA splicing factor SRP32 (srp32) gene, complete cds,686000321 (28)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013G01- CTTTTTTTTGAGTT-TTAATAAACTA-GTCATCATCCAAACAAC
rJMFF013N10- TTAATAAACTA-GTCATCATCCAAACAAC
rJMSF012H12- AACAAC
rJMFF019E19- TTTTTTTGAGTTATTAATAAACTA-GTCATCATCCAAACAAC
rJMFF039A01- ATAAACTA-GTCATCATCCAAACAAC
rJMSF048B23- TCATCCAAACAAC
rJMFF039G06- TAATAAACTANGTCATCATCCAAACAAC
rJMFF039D07- TCATCATCCAAACAAC
rJMSF004N13- GTCATCATCCAAACAAC
rJMFF006G22- TTTTTTTGAGTTATTAATAAACTA-GTCATCATCCAAACAAC
                      ____________________________________________________________
consensus CTTTTTTTTGAGTTATTAATAAACTA-GTCATCATCCAAACAAC
 
. : . : . : . : . : . :
rJMFF013G01- CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
rJMFF013N10- CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
rJMSF012H12- CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
rJMFF019E19- CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
rJMFF039A01- CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
rJMSF048B23- CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
rJMFF039G06- CAATTATGGTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
rJMFF039D07- CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
rJMSF004N13- CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
rJMSF037P07- TACAATACCTANACCAATAATACAGCTCCCAGAATTAGTATTTAG
rJMFF006G22- CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
                      ____________________________________________________________
consensus CAATTAT-GTAGAAATACAATACCTAAACCAATAATACAGCTCCAAGAATTAGTATTTAG
 
. : . : . : . : . : . :
rJMFF013G01- CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMFF013N10- CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMSF012H12- CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMFF019E19- CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMFF039A01- CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMSF048B23- CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMFF039G06- CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMFF039D07- CAATTCTTAAGAAAAATACATAGCAAAGNATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMSF006E13- ATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMSF004N13- CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
rJMSF037P07- CAATTCTNAAGAAAAATACATAGCANAGTANAACCTGGTCCGATGCCACTAAATTGTCCA
rJMFF006G22- CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
                      ____________________________________________________________
consensus CAATTCTTAAGAAAAATACATAGCAAAGTATAACCTGGTCCGATGCCA-TAAATTGTCCA
 
. : . : . : . : . : . :
rJMFF013G01- ACAAGCTC-AAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMFF013N10- ACAAGCTC-AAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMSF012H12- ACAAGCTCAAAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMFF019E19- ACAAGCTCAAAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMFF039A01- ACAAGCTCAAAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMSF048B23- ACAAGCTCAAAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMFF039G06- ACAAGCTCAAAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMFF039D07- ACAAGCTCAAAAAGGTTTAGGCAATATANAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMSF006E13- ACAAGCTCAAAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMSF004N13- ACAAGCTCAAAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMSF037P07- ACAAGCTCGAAAAGGTTTAGGNAATATANAGAATTCACTCTGCTTGATCTGTGAAATGTA
rJMFF006G22- ACAAGCTCAAAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
                      ____________________________________________________________
consensus ACAAGCTCAAAAAGGTTTAGGCAATATAGAGAATTCACTCTGCTTGATCTGTGAAATGTA
 
. : . : . : . : . : . :
rJMFF013G01- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
rJMFF013N10- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
rJMSF012H12- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
rJMFF019E19- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
rJMFF039A01- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
rJMSF048B23- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
rJMFF039G06- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
rJMFF039D07- ACACANAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGNGTAAATGATCANTCAT
rJMSF006E13- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
rJMSF004N13- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
rJMSF037P07- ACACA
rJMFF006G22- ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
                      ____________________________________________________________
consensus ACACAGAAGATATCGGGTGGCGGCACACATTCACAGCTTCAGGTGTAAATGATCAGTCAT
 
. : . : . : . : . : . :
rJMFF013G01- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGACTGCGGCTGCGGCTAGAACTCCGTTT
rJMFF013N10- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGACTGCGGCTGCGGCTAGAACTCCGTTT
rJMSF012H12- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
rJMFF019E19- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
rJMFF039A01- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
rJMSF048B23- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
rJMFF039G06- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
rJMFF039D07- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
rJMSF006E13- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
rJMSF004N13- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
rJMFF006G22- CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
                      ____________________________________________________________
consensus CGCCCAAGCTTACCTGGATAAACTCCTGCTGCGGCTGCGGCTGCGGCTAGAACTCCGTTT
 
. : . : . : . : . : . :
rJMFF013G01- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
rJMFF013N10- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
rJMSF012H12- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
rJMFF019E19- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
rJMFF039A01- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
rJMSF048B23- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
rJMFF039G06- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
rJMFF039D07- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
rJMSF006E13- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
rJMSF004N13- CTTT
rJMFF006G22- CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
                      ____________________________________________________________
consensus CTTTGGGCTAGAACTCCTTTTCTTTGGGCTAGAACTCCGTTTCTTTGGGCTTTCACTGAC
 
. : . : . : . : . : . :
rJMFF013G01- TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
rJMFF013N10- TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
rJMSF012H12- TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
rJMFF019E19- TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
rJMFF039A01- TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
rJMSF048B23- TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
rJMFF039G06- TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
rJMFF039D07- TTCTTTCTTACNAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATANAGCG
rJMSF006E13- TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
rJMFF006G22- TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
JMSF021N10+ CTTGACATAGAGCG
                      ____________________________________________________________
consensus TTCTTTCTTACGAGAAGGCACTGGGGACCTGGATCTTGATAAAGATCTTGACATAGAGCG
 
. : . : . : . : . : . :
rJMFF013G01- TCCTTTTGACCTAGAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
rJMFF013N10- TCCTTTTGACCTAGAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
rJMSF012H12- TCCTTTTGACCTAGAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
rJMFF019E19- TCCTTTTGACCTAGAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
rJMFF039A01- TCCTTTTGACCTAGAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
rJMSF048B23- TCCTTTTGACCTAGAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
rJMFF039G06- TCCTTTTGACCTACAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
rJMFF039D07- TCCTTTTGACCTANAAGGGGATCGNGATGGAGACTTTGAACGAGATCTTGAACGNCGAGA
rJMSF006E13- TCCTTTTGACCTAGAAGGGGATCGTGATGNAGACTTTGAACGAGATCTTGAACGTCGAGN
rJMFF006G22- TCCTTTTGACCTAGAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
JMSF021N10+ TCCTTTTGACCTAGAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
JMFS162H07+ TGAACGTCGAGA
                      ____________________________________________________________
consensus TCCTTTTGACCTAGAAGGGGATCGTGATGGAGACTTTGAACGAGATCTTGAACGTCGAGA
 
. : . : . : . : . : . :
rJMFF013G01- AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
rJMFF013N10- AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
rJMSF012H12- AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
rJMFF019E19- AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
rJMFF039A01- AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
rJMSF048B23- AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
rJMFF039G06- AGATTTGGCCTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
rJMFF039D07- AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCG
rJMSF006E13- ANATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTA
rJMFF006G22- AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
JMSF021N10+ AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
JMFS162H07+ AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
                      ____________________________________________________________
consensus AGATTTGG-CTTTAGGAGATTTGCTTCTGCTCCTGCTACGACTATAACTTCGGCTTCGAT
 
. : . : . : . : . : . :
rJMFF013G01- TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
rJMFF013N10- TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
rJMSF012H12- TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
rJMFF019E19- TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
rJMFF039A01- TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
rJMSF048B23- TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
rJMFF039G06- TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCNACTGCGGN
rJMFF006G22- TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
JMSF021N10+ TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
JMSF006E13+ CCTCNTGAATAAGAACGACTCCGGCTGCGACTGCGGC
JMFS162H07+ TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
JMSF048B23+ CCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
                      ____________________________________________________________
consensus TACGACTACGGCTGCCATTCTTTCCTCCTGAATAAGAACGACTCCGGCTGCGACTGCGGC
 
. : . : . : . : . : . :
rJMFF013G01- TTC-GGCTTCTTGAGCGACCTGGAATTGTATTCCTTAACATATATTACTGCACGTCCNAA
rJMFF013N10- TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
rJMSF012H12- TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
rJMFF019E19- TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
rJMFF039A01- TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
rJMSF048B23- TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
rJMFF039G06- TTCGGGCTTCTTGAGCGACCT-GAATTGT
rJMFF006G22- TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
JMSF021N10+ TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
JMSF006E13+ TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
JMFS162H07+ TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
JMFF019E19+ TTAACATATATTACTGCACGTCCAAA
JMFS034E03+ T-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
JMSF027I01+ TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
JMFF039A01+ TCCTTAACATATATTACTGCACGTCCAAA
JMSF048B23+ TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
                      ____________________________________________________________
consensus TTC-GGCTTCTTGAGCGACCT-GAATTGTATTCCTTAACATATATTACTGCACGTCCAAA
 
. : . : . : . : . : . :
rJMFF013G01- TGCATTCC
rJMFF013N10- TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
rJMSF012H12- TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
rJMFF019E19- TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCAT
rJMFF039A01- TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
rJMSF048B23- TGCATTCCGAAATTCAGA
rJMFF006G22- TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
JMSF021N10+ TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
JMSF006E13+ TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
JMFS162H07+ TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
JMFF019E19+ TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
JMFS034E03+ TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
JMSF027I01+ TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
JMFF039A01+ TGCATTCNGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
JMFF013G01+ ATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
JMSF048B23+ TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
                      ____________________________________________________________
consensus TGCATTCCGAAATTCAGACTCATCAAGTTTTTTTATAGCATGCTTCATATCATCATAGTT
 
. : . : . : . : . : . :
rJMFF013N10- GGTGTAGTCCACTATCCCAGACATCCCACTCCCC
rJMSF012H12- GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTC
rJMFF006G22- GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAA
JMSF021N10+ GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMSF006E13+ GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMFS162H07+ GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMFF039D07+ CCTCACGAAAAACTTGGGAGAAACAAAC
JMFF019E19+ GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMFS034E03+ GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMSF027I01+ GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMFF039A01+ GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMFF013N10+ CCCTCACGAAAAACTTGGGAGAAACAAAC
JMFF013G01+ GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMSF012H12+ CCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMSF048B23+ GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
JMFF006G22+ TCACGAAAAACTTGGGAGAAACAAAC
                      ____________________________________________________________
consensus GGTGTAGTCCACTATCCCAGACATCCCACTCCCCTCACGAAAAACTTGGGAGAAACAAAC
 
. : . : . : . : . : . :
JMSF021N10+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMSF006E13+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAATCTGGGCAATC
JMFS162H07+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMFF039D07+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMFF019E19+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMFS034E03+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMSF027I01+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMFF039A01+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMFF013N10+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMFF013G01+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMSF012H12+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMSF048B23+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
JMFF006G22+ ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
                      ____________________________________________________________
consensus ATCCCCAGCTCGACGCATGTGATCCTTAAGATCTTGCCATGAAGCAGAA-CTGGGCAATC
 
. : . : . : . : . : . :
JMSF021N10+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCT
JMSF006E13+ CA
JMFS162H07+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMFF039D07+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMFF019E19+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMFS034E03+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMSF027I01+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMFF039A01+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMFF013N10+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMFF013G01+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMSF012H12+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMSF048B23+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
JMFF006G22+ CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
                      ____________________________________________________________
consensus CAGTGACTAACACTCGATAGTCAGAACGCCTTGACACTCCTCCTCGAGGACCTCGACCAC
 
. : . : . : . : . : . :
JMFS162H07+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMFF039D07+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMFF019E19+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMFS034E03+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMSF027I01+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMFF039A01+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMFF013N10+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMFF013G01+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMSF012H12+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMSF048B23+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
JMFF006G22+ TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
                      ____________________________________________________________
consensus TGCTGCTGTGGCTACTGTGGCGATCATTAGAGAGTGAGTGACCACGACCACCATGGGCCA
 
. : . : . : . : . : . :
JMFS162H07+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMFF039D07+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMFF019E19+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMFS034E03+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMSF027I01+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMFF039A01+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMFF013N10+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMFF013G01+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMSF012H12+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMSF048B23+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
JMSF004P15+ GAATAGCATCAT
JMSF037P07+ TAGCATCAT
JMFF006G22+ GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
                      ____________________________________________________________
consensus GCTCAACCCGCAACCGATGCCCATCAAAATCATAGCCATCACGACCACGAATAGCATCAT
 
. : . : . : . : . : . :
JMFS162H07+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMFF039D07+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMFF019E19+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMFS034E03+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMSF027I01+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMFF039A01+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMFF013N10+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMFF013G01+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMSF012H12+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMSF048B23+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMSF004P15+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
JMSF037P07+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTNGGAGGAAGTT
JMFF006G22+ CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
                      ____________________________________________________________
consensus CAGCATCATGAGCATCTTTAAACTCAACAAAAGCATAACCAGGAGGTCTTGGAGGAAGTT
 
. : . : . : . : . : . :
JMFS162H07+ TCAAATCAA
JMFF039D07+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMFF019E19+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMFS034E03+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMSF027I01+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMFF039A01+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMFF013N10+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMFF013G01+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMSF012H12+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMSF048B23+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMSF004P15+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMFF039G06+ AATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
JMSF037P07+ TCAAATCNATNTGTGCANTTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGNTCAC
JMFF006G22+ TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
                      ____________________________________________________________
consensus TCAAATCAATATGTGCAATTGGTCCATACTTGTAAAACAAATCCTCAACTTCCCGCTCAC
 
. : . : . : . : . : . :
JMFF039D07+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
JMFF019E19+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
JMFS034E03+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
JMSF027I01+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
JMFF039A01+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGAGACTCATATTTATCC
JMFF013N10+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGAGACTCATATTTATCC
JMFF013G01+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGAGACTCATATTTATCC
JMSF012H12+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
JMSF048B23+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
JMSF004P15+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
JMFF039G06+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
JMSF037P07+ GAATATCTCCNGGAAGNTTNCCAACATAGAGA
JMFF006G22+ GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
                      ____________________________________________________________
consensus GAATATCTCCAGGAAGATTACCAACATAGAGAGTCCTGCTAGAGCGACTCATATTTATCC
 
. : . : . : . : . : . :
JMFF039D07+ TTTAGAGACCGATGAATGAGCAAGGAGCGC
JMFF019E19+ TTTAGAGACCGATGAATGAGCAAGGAGCGC
JMFS034E03+ TTTAGAGACCGATGAA
JMSF027I01+ TTTAGAGACCGATGAATGAGCAAGGAGCGCAGAGTC
JMFF039A01+ TTTAGAGACCGATGAATGAGCAAGGAGCGCAGAGTCACT
JMFF013N10+ TTTAGAGACCGATGAATGAGCAAGGAGCGCAGAGCCACT
JMFF013G01+ TTTAGAGACCGATGAATGAGCAAGGAGCGCAGAGCCACT
JMSF012H12+ TTTAGAGACCGATGAATGAGCAAGGAGCGCAGAGTCACT
JMSF048B23+ TTTAGAGACCGATGAATGAGCAAGGAGCGCAGAGTCACT
JMSF004P15+ TTTAGAGACCGATGAATGAGCAAGGAGCGCAGAGTC
JMFF039G06+ TTTAGAGACCGATGAATGAGCAAGGAGCGC
JMFF006G22+ TTTAGAGACCGATGAATGAGCAAGGAGCGCAGAGTCACTGACAAAGCGAGAGTCGAAGAC
                      ____________________________________________________________
consensus TTTAGAGACCGATGAATGAGCAAGGAGCGCAGAGTCACTGACAAAGCGAGAGTCGAAGAC