Previous Contig 000320:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006G17Sequence526000320 (2)pir|C84870|C848701e-47probable splicing factor [imported] - Arabidopsis thaliana>gb:AC002333_1530348 A717008435 (2)pir|C84870|C848704e-92probable splicing factor [imported] - Arabidopsis thaliana>gb:AC002333_1530348 A
JMSF005E24Sequence374000320 (2)pir|C84870|C848702e-24probable splicing factor [imported] - Arabidopsis thaliana>gb:AC002333_1530348 A254008435 (2)pir|C84870|C848708e-27probable splicing factor [imported] - Arabidopsis thaliana>gb:AC002333_1530348 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF006G17+ TATCTGTTTTCCAGTTTCAACATCCCAAGCTCTCAGAGTCTTGTCAG
                      ____________________________________________________________
consensus TATCTGTTTTCCAGTTTCAACATCCCAAGCTCTCAGAGTCTTGTCAG
 
. : . : . : . : . : . :
JMFF006G17+ GGCTTGCCGATATTATGGCTGACCCATCAGTCATCCACTGAACATCCAGAACAGCATTNT
                      ____________________________________________________________
consensus GGCTTGCCGATATTATGGCTGACCCATCAGTCATCCACTGAACATCCAGAACAGCATTNT
 
. : . : . : . : . : . :
JMSF005E24+ GTATACATTCCAAAGAAAAATTT
JMFF006G17+ TGTGCCCTTTTAACACCATAAAGTTTTTGCATTCACCGTATACATTCCAAAGAAAAATTT
                      ____________________________________________________________
consensus TGTGCCCTTTTAACACCATAAAGTTTTTGCATTCACCGTATACATTCCAAAGAAAAATTT
 
. : . : . : . : . : . :
JMSF005E24+ CTTTATCATGTGAACCAGATGCAATTACAGTTCCTGCAGCATTGAACTTCATTGTGTATA
JMFF006G17+ NTTTATCATGTGAACCAGATGCAATTACAGTTCCTGCAGCATTGAACTTCATTGTGTATA
                      ____________________________________________________________
consensus CTTTATCATGTGAACCAGATGCAATTACAGTTCCTGCAGCATTGAACTTCATTGTGTATA
 
. : . : . : . : . : . :
JMSF005E24+ TGGCACTTTGATGTCCTGTTAGTAACATGATTGGAGATTCCAAGCCGGATGTTCGCTGTT
JMFF006G17+ TGGCACTTTGATGTCCTGTTAGTAACATGATTGGAGATTCCAAGCCGGATGTTCGCTGTT
                      ____________________________________________________________
consensus TGGCACTTTGATGTCCTGTTAGTAACATGATTGGAGATTCCAAGCCGGATGTTCGCTGTT
 
. : . : . : . : . : . :
JMSF005E24+ TCCCATTTGGTCCAGGTGCTTTAGGACCACTGAAAGGAACAGACAGTTCCATTGGTCTTG
JMFF006G17+ TCCCATTTGGTCCAGGTGCTTTAGGACCNCTGAAAGGAACAGACAGTTCCATTGGTNTTG
                      ____________________________________________________________
consensus TCCCATTTGGTCCAGGTGCTTTAGGACCACTGAAAGGAACAGACAGTTCCATTGGTCTTG
 
. : . : . : . : . : . :
JMSF005E24+ GACCAATGACAGACAAAGCACTTTCTGTTTGCATTCTTCTTTTTTCTTCTATTCGATCTT
JMFF006G17+ GACCAATGACAGACAAAGCACTTTCTGTTTGCATTCTTCTTTTTTCTTCTATTCGATCTT
                      ____________________________________________________________
consensus GACCAATGACAGACAAAGCACTTTCTGTTTGCATTCTTCTTTTTTCTTCTATTCGATCTT
 
. : . : . : . : . : . :
JMSF005E24+ CAGTATTTGAAAAGCAGTATCTGTCAG-----CTTGATTACTAATAGGGCTTCGACCACC
JMFF006G17+ CAGTATTTGAAAAGCAGTATCTGTCAGCTGGACTTGATTACTAATAGGGCTTCGACCACC
                      ____________________________________________________________
consensus CAGTATTTGAAAAGCAGTATCTGTCAGCTGGACTTGATTACTAATAGGGCTTCGACCACC
 
. : . : . : . : . : . :
JMSF005E24+ GTAAAACCCTAGGGTTCTTCTTCAAGAGACCAGGTGGAGAAGCAAAGACGTCAGT
JMFF006G17+ GTAAAACCCTAGGGTTNTTNTTCAAGAGA-CAGGTGGAGAAGCAAAGACGTCAGTGTCTC
                      ____________________________________________________________
consensus GTAAAACCCTAGGGTTCTTCTTCAAGAGACCAGGTGGAGAAGCAAAGACGTCAGTGTCTC