Previous Contig 000319:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F15Sequence494000319 (12)sp|O81361|RS8_PRUAR3e-5140S ribosomal protein S8.>gb:AF071889_1765813 Prunus armeniaca 40S ribosomal pro629000319 (12)gb:OSJN00241_11909581e-55Oryza sativa (japonica cultivar-group) chromosome 4 clone OSJNBa0038P21, *** SEQ
JMFF006G15Sequence493000319 (12)sp|O81361|RS8_PRUAR4e-4840S ribosomal protein S8.>gb:AF071889_1765813 Prunus armeniaca 40S ribosomal pro810000319 (12)gb:OSJN00241_11909581e-79Oryza sativa (japonica cultivar-group) chromosome 4 clone OSJNBa0038P21, *** SEQ
JMFF014L13Sequence587000319 (12)gb:OSJN00241_11909581e-63Oryza sativa (japonica cultivar-group) chromosome 4 clone OSJNBa0038P21, *** SEQ
JMFF024E06Sequence427000319 (12)gb:AP004837_18457496e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048773000319 (12)gb:OSJN00241_11909581e-77Oryza sativa (japonica cultivar-group) chromosome 4 clone OSJNBa0038P21, *** SEQ
JMFF036B10Sequence472000319 (12)sp|O81361|RS8_PRUAR1e-4940S ribosomal protein S8.>gb:AF071889_1765813 Prunus armeniaca 40S ribosomal pro
JMFF042N17Sequence647000319 (12)gb:OSJN00241_11909582e-74Oryza sativa (japonica cultivar-group) chromosome 4 clone OSJNBa0038P21, *** SEQ
JMFN016H16Sequence545000319 (12)sp|O81361|RS8_PRUAR4e-5140S ribosomal protein S8.>gb:AF071889_1765813 Prunus armeniaca 40S ribosomal pro
JMSF041F13Sequence733000319 (12)gb:OSJN00241_11909582e-69Oryza sativa (japonica cultivar-group) chromosome 4 clone OSJNBa0038P21, *** SEQ681000319 (12)gb:OSJN00241_11909582e-69Oryza sativa (japonica cultivar-group) chromosome 4 clone OSJNBa0038P21, *** SEQ

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF001F15- ATAAAACGAAGTGCA
JMSF041F13+ TTTTTTTTTTAAAACAAACCAGTTCAGAAGACCAATAAAACGAAGTGCA
rJMFF024E06- ATAAAACGAAGTGCA
rJMFF006G15- ATAAAACGAAGTGCA
                      ____________________________________________________________
consensus TTTTTTTTTTAAAACAAACCAGTTCAGAAGACCAATAAAACGAAGTGCA
 
. : . : . : . : . : . :
rJMSF041F13- GTCCAAAACTACATAGTATCCAGCACAAGGAACCAAGCTGTCAATGTTGG
rJMFF001F15- TACAAAACTTGTCCAAAACTACATAGTATCCAGCACAAGGAACCAAG-TGTCAATGTTGG
JMSF041F13+ TACAAAACTTGTCCAAAACTACATAGTATCCAGCACAAGGAACCAAG-TGTCAATGTTGG
rJMFF024E06- TACAAAACTTGTCCAAAACTACATAGTATCCAGCACAAGGAACCAAG-TGTCAATGTTGG
rJMFF006G15- TACAAAACTTGTCCAAAACTACATAGTATCCAGCACAAGGAACCAAG-TGTCAATGTTGG
                      ____________________________________________________________
consensus TACAAAACTTGTCCAAAACTACATAGTATCCAGCACAAGGAACCAAG-TGTCAATGTTGG
 
. : . : . : . : . : . :
rJMSF041F13- TACACAAGGGAGGTGAGCAACAAAATAGAAAACTAGATTGACTTCAAAGGATCTTATAAG
rJMFF001F15- TACACAAGGGAGGTGAGCAACAAAATAGAAAACTAGATTGACTTCAAAGGATCTTATAAG
JMSF041F13+ TACACAAGGGAGGTGAGCAACAAAATAGAAAACTAGATTGACTTCAAAGGATCTTATAAG
rJMFF024E06- TACACAAGGGAGGTGAGCAACAAAATAGAAAACTAGATTGACTTCAAAGGATCTTATAAG
rJMFF006G15- TACACAAGGGAGGTGAGCAACAAAATAGAAAACTAGATTGACTTCAAAGGATCTTATAAG
                      ____________________________________________________________
consensus TACACAAGGGAGGTGAGCAACAAAATAGAAAACTAGATTGACTTCAAAGGATCTTATAAG
 
. : . : . : . : . : . :
rJMSF041F13- ATCAGATGATGATTAGGCAGTTGCACCAGAACCTTTTCCCTTCTTCCTCTGAATCTTCTT
rJMFF001F15- ATCAGATGATGATTAGGCAGTTGCACCAGAACCTTTTCCCTTCTTCCTCTGAATCTTCTT
JMSF041F13+ ATCAGATGATGATTAGGCAGTTGCACCAGAACCTTTTCCCTTCTTCCTCTGAATCTTCTT
rJMFF024E06- ATCAGATGATGATTAGGCAGTTGCACCAGAACCTTTTCCCTTCTTCCTCTGAATCTTCTT
rJMFF006G15- ATCAGATGATGATTAGGCAGTTGCACCAGAACCTTTTCCCTTCTTCCTCTGAATCTTCTT
                      ____________________________________________________________
consensus ATCAGATGATGATTAGGCAGTTGCACCAGAACCTTTTCCCTTCTTCCTCTGAATCTTCTT
 
. : . : . : . : . : . :
rJMSF041F13- CATGTAGAATTCCAGTTCCTTTCCTTCCAAGATATACCCATCAGCCCTGCCACACTGGCC
rJMFF001F15- CATGTAGAATTCCAGTTCCTTTCCTTCCAAGATATACCCATCAGCCCTGCCACACTGGCC
JMSF041F13+ CATGTAGAATTCCAGTTCCTTTCCTTCCAAGATATACCCATCAGCCCTGCCACACTGGCC
rJMFF024E06- CATGTAGAATTCCAGTTCCTTTCCTTCCAAGATATACCCATCAGCCCTGCCACACTGGCC
rJMFF006G15- CATGTAGAATTCCAGTTCCTTTCCTTCCAAGATATACCCATCAGCCCTGCCACACTGGCC
JMFF042N17+ CACTGGCC
                      ____________________________________________________________
consensus CATGTAGAATTCCAGTTCCTTTCCTTCCAAGATATACCCATCAGCCCTGCCACACTGGCC
 
. : . : . : . : . : . :
rJMSF041F13- TGGTCGTGATGCAATGCATGCCATCAATCTGCCCGACCCAAACTGCTCTTCAAGGTGGGA
rJMFF001F15- TGGTCGTGATGCAATGCATGCCATCAATCTGCCCGACCCAAACTGCTCTTCAAGGTGGGA
JMSF041F13+ TGGTCGTGATGCAATGCATGCCATCAATCTGCCCGACCCAAACTGCTCTTCAAGGTGGGA
rJMFF024E06- TGGTCGTGATGCAATGCATGCCATCAATCTGCCCGACCCAAACTGCTCTTCAAGGTGGGA
rJMFF006G15- TGGTCGTGATGCAATGCATGCCATCAATCTGCCCGACCCAAACTGCTCTTCAAGGTGGGA
JMFF042N17+ TGGTCGTGATGCAATGCATGCCATCAATCTGCCCGACCCAAACTGCTCTTCAAGGTGGGA
JMFF014L13+ AGGTGGGA
                      ____________________________________________________________
consensus TGGTCGTGATGCAATGCATGCCATCAATCTGCCCGACCCAAACTGCTCTTCAAGGTGGGA
 
. : . : . : . : . : . :
rJMSF041F13- ATCAAGCTTGCGATCTTTCTGACGTTTTTCAATCTTCCTTACCACATGGTTACTCTTCTT
rJMFF001F15- ATCAAGCTTGCGATCTTTCTGACGTTTTTCAATCTTCCTTACCACATGGTTACTCTTCTT
JMSF041F13+ ATCAAGCTTGCGATCTTTCTGACGTTTTTCAATCTTCCTTACCACATGGTTACTCTTCTT
rJMFF024E06- ATCAAGCTTGCGATCTTTCTGACGTTTTTCAATCTTCCTTACCACATGGTTACTCTTCTT
rJMFF006G15- ATCAAGCTTGCGATCTTTCTGACGTTTTTCAATCTTCCTTACCACATGGTTACTCTTCTT
JMFF042N17+ ATCAAGCTTGCGATCTTTCTGACGTTTTTCAATCTTCCTTACCACATGGTTACTCTTCTT
JMFF014L13+ ATCAAGCTTGCGATCTTTCTGACGTTTTTCAATCTTCCTTACCACATGGTTACTCTTCTT
                      ____________________________________________________________
consensus ATCAAGCTTGCGATCTTTCTGACGTTTTTCAATCTTCCTTACCACATGGTTACTCTTCTT
 
. : . : . : . : . : . :
rJMSF041F13- GGTTTCCTCAGGTGCAGTTGCGCCTTCACCTTCCTCATTCGTTTCCTTCTTAGCAGCAGC
rJMFF001F15- GGTTTCCTCAGGTGCAGTTGCGCCTTCACCTTCCTCATTCGTTTCCTTCTTAGCAGCAGC
JMSF041F13+ GGTTTCCTCAGGTGCAGTTGCGCCTTCACCTTCCTCATTCGTTTCCTTCTTAGCAGCAGC
rJMFF024E06- GGTTTCCTCAGGTGCAGTTGCGCCTTCACCTTCCTCATTCGTTTCCTTCTTAGCAGCAGC
rJMFF006G15- GGTTTCCTCAGGTGCAGTTGCGCCTTCACCTTCCTCATTCGTTTCCTTCTTAGCAGCAGC
JMFF042N17+ GGTTTCCTCAGGTGCAGTTGAGCCTTCACCTTCCTCATTCGTTTCCTTCTTAGCAGCAGC
JMFN016H16+ CCTCATTCGTTTCCTTCTTAGCAGCAGC
JMFF014L13+ GGTTTCCTCAGGTGCAGTTGAGCCTTCACCTTCCTCATTCGTTTCCTTCTTAGCAGCAGC
JMFF036B10+ TCTTAGCAGCAGC
JMFF001F15+ CCTCATTCGTTTCCTTCTTAGCAGCAGC
JMFF006G15+ CTTCTTAGCAGCAGC
                      ____________________________________________________________
consensus GGTTTCCTCAGGTGCAGTTGCGCCTTCACCTTCCTCATTCGTTTCCTTCTTAGCAGCAGC
 
. : . : . : . : . : . :
rJMSF041F13- CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
rJMFF001F15- CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
JMSF041F13+ CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
rJMFF024E06- CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
rJMFF006G15- CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
JMFF042N17+ CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
JMFN016H16+ CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
JMFF014L13+ CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
JMFF036B10+ CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
JMFF001F15+ CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
JMFF024E06+ TTTGAATGG
JMFF006G15+ CGACTTNTTNTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
                      ____________________________________________________________
consensus CGACTTCTTCTTCCTACCAATATCAACACCATAGTGCTGAAGGTACCATTGTTTGAATGG
 
. : . : . : . : . : . :
rJMSF041F13- AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
rJMFF001F15- AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
JMSF041F13+ AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
rJMFF024E06- AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
rJMFF006G15- AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
JMFF042N17+ AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
JMFN016H16+ AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
JMFF014L13+ AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
JMFF036B10+ AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
JMFF001F15+ AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
JMFF024E06+ AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
JMFF006G15+ AGCAGCATCCNCCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
                      ____________________________________________________________
consensus AGCAGCATCCACCTGAACAATGGCACTTTTCACCAGAGTTTGGGTCCTCACAAGTTCATT
 
. : . : . : . : . : . :
rJMSF041F13- GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
rJMFF001F15- GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTTCCCGGGGAACAGCTTCACTGC
JMSF041F13+ GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
rJMFF024E06- GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
rJMFF006G15- GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
JMFF042N17+ GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
JMFN016H16+ GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
JMFF014L13+ GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
JMFF036B10+ GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
JMFF001F15+ GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
JMFF024E06+ GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
JMFF006G15+ GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
                      ____________________________________________________________
consensus GTTTGAGGCATTATATACCACATCAAGAATACGTGTCTT-CCGGGTAACAGCTTCACTG-
 
. : . : . : . : . : . :
rJMSF041F13- CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
rJMFF001F15- CCCCATGAGTAGT
JMSF041F13+ CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
rJMFF024E06- CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
rJMFF006G15- CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
JMFF042N17+ CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
JMFN016H16+ CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
JMFF014L13+ CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
JMFF036B10+ CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
JMFF001F15+ CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
JMFF024E06+ CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
JMFF006G15+ CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
                      ____________________________________________________________
consensus CCCCATGAGTAGTTTCCTGTATCCAGCCTGAGTGCTCTCCACTTCACATTGCCTCCCCTA
 
. : . : . : . : . : . :
rJMSF041F13- ACTCGAACTCTCCTAACAGTCTTGTTG
JMSF041F13+ ACTCGAACTCTCCTAACAGTCTTGTTG
rJMFF024E06- ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
rJMFF006G15- ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
JMFF042N17+ ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
JMFN016H16+ ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
JMFF014L13+ ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
JMFF036B10+ ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
JMFF001F15+ ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
JMFF024E06+ ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
JMFF006G15+ ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
                      ____________________________________________________________
consensus ACTCGAACTCTCCTAACAGTCTTGTTGCTCGAGAGTTTAGTATTTGCTGGCTGACGCCCA
 
. : . : . : . : . : . :
rJMFF024E06- AGCTCATACTTTCTCTTCTTCCTCCATGCCTTCTTCTTGCC
rJMFF006G15- AGCTCATACTTTCTCTTCTTCCTCCATGCCTTCTTCTTGCCACCAGTGGCTCGCCTCTTG
JMFF042N17+ AGCTCATACTTTCTCTTCTTCCTCCATGCCTTCTTCTTGCCACCAGTGGCTCGCCTCTTG
JMFN016H16+ AGCTCATACTTTCTCTTCTTCCTCCATGCCTTCTTCTTGCCACCAGTGGCTCGCCTCTTG
JMFF014L13+ AGCTCATACTTTCTCTTCTTCCTCCATGCCTTCTTCTTGCCACCAGTGGCTCGCCTCTTG
JMFF036B10+ AGCTCATACTTTCTCTTCTTCCTCCATGCCTTCTTCTTGCCACCAGTGGCTCGCCTCTTG
JMFF001F15+ AGCTCATACTTTCTCTTCTTCCTCCATGCCTTCTTCTTGCCACCAGTGGCTCGCCTCTTG
JMFF024E06+ AGCTCATACTTTCTCTTCTTCCTCCATGCCTTCTTCTTGCCACCAGTGGCTCGCCTCTTG
JMFF006G15+ AGCTCATACTTTCTCTTNTTCCTCCATGCCTTCTTCTTGCCACCAGTGGCTCGCCTCTTG
                      ____________________________________________________________
consensus AGCTCATACTTTCTCTTCTTCCTCCATGCCTTCTTCTTGCCACCAGTGGCTCGCCTCTTG
 
. : . : . : . : . : . :
rJMFF006G15- TGCATCGAATCTCTTGA
JMFF042N17+ TGCATCGAATCTCTTGAGATACCCATAGCTGCGTTGGTGCTATAGAGATTCTCTTCAGCT
JMFN016H16+ TGCATCGAATCTCTTGAGATACCCATAGCTGCGTTGGTGCTATAGAGATTCTC
JMFF014L13+ TGCATCGAATCTCTTGAGATACCCATAGCTGCGTTGGTGCTATAGAGATTCTCTTCAGCT
JMFF036B10+ TGCATCGAATCTCTTGAGATACCCATAGCTGCGTTGGTGCTATAGAGATTCTCTTCAGCT
JMFF001F15+ TGCATCGAATCTCTTGAGATACCCATAGCTGCGTTGGTGCTATAGAGATTCTCTTCAGCT
JMFF024E06+ TGCATCGAATCTCTTGAGATACCCATAGCTGCGTTGGTGCTATAGAGATTCTCTTCAGCT
JMFF006G15+ TGCATCGAATCTCTTGAGATACCCATAGCTGCGTTGGTGCTATAGAGATTCTCTTCAGCT
                      ____________________________________________________________
consensus TGCATCGAATCTCTTGAGATACCCATAGCTGCGTTGGTGCTATAGAGATTCTCTTCAGCT
 
. : . : . : . : . : . :
JMFF042N17+ TCACTCACTCACTCACTCTCTCTCTCTCTCTCTCTCT
JMFF014L13+ TCACTCACTCACTCACTCTCTCTCTCTCTCTCTCTCT
JMFF036B10+ TCACTCACTCACTCACTCTCTCTCTCTCTCTCTCTCT
JMFF001F15+ TCACTCACTCACTCACTCTCTCTCTCTCTCTCTCTCT
JMFF024E06+ TCACTCACTCACTCACTCTCTCTCTCTCTCTCTCTCTCACTCTCTTTCTGTCACAATCCT
JMFF006G15+ TCACTCACTCACTCACTCTCTCTCTCTCTCTCTCTCTCACTCTCTTTCTGTCACAATCCT
                      ____________________________________________________________
consensus TCACTCACTCACTCACTCTCTCTCTCTCTCTCTCTCTCACTCTCTTTCTGTCACAATCCT